FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637296_at:

>probe:Drosophila_2:1637296_at:606:69; Interrogation_Position=151; Antisense; AGGCGGCTCCAAGTCGATGCTCGGC
>probe:Drosophila_2:1637296_at:638:445; Interrogation_Position=166; Antisense; GATGCTCGGCCAGTTGCTGTTGGAC
>probe:Drosophila_2:1637296_at:262:469; Interrogation_Position=178; Antisense; GTTGCTGTTGGACCGTCGCACGTAA
>probe:Drosophila_2:1637296_at:380:135; Interrogation_Position=206; Antisense; ACGCTGCAGCGGAACTACTGAGTTT
>probe:Drosophila_2:1637296_at:603:665; Interrogation_Position=221; Antisense; TACTGAGTTTTGGTTCGGATCGGAA
>probe:Drosophila_2:1637296_at:166:247; Interrogation_Position=244; Antisense; AATTCGCATCGAGTTTGGGCTTCGG
>probe:Drosophila_2:1637296_at:585:695; Interrogation_Position=269; Antisense; TTTCGGCTGCTGTCGGATTTATCGG
>probe:Drosophila_2:1637296_at:672:457; Interrogation_Position=284; Antisense; GATTTATCGGTCGTTTTGGTCCGCT
>probe:Drosophila_2:1637296_at:338:725; Interrogation_Position=299; Antisense; TTGGTCCGCTTGATCGGTTGGCCAA
>probe:Drosophila_2:1637296_at:725:317; Interrogation_Position=31; Antisense; GCCGGCATTCGAAACTCTCCAAAGT
>probe:Drosophila_2:1637296_at:653:539; Interrogation_Position=314; Antisense; GGTTGGCCAACTGCAAACTCGGCGG
>probe:Drosophila_2:1637296_at:305:179; Interrogation_Position=328; Antisense; AAACTCGGCGGCCTGCATTCGGCAG
>probe:Drosophila_2:1637296_at:191:3; Interrogation_Position=358; Antisense; ATTGATGGACTGCAGTTGCTCCGCA
>probe:Drosophila_2:1637296_at:640:215; Interrogation_Position=52; Antisense; AAGTTGGCGCCAAAAGTGCCGCCTG

Paste this into a BLAST search page for me
AGGCGGCTCCAAGTCGATGCTCGGCGATGCTCGGCCAGTTGCTGTTGGACGTTGCTGTTGGACCGTCGCACGTAAACGCTGCAGCGGAACTACTGAGTTTTACTGAGTTTTGGTTCGGATCGGAAAATTCGCATCGAGTTTGGGCTTCGGTTTCGGCTGCTGTCGGATTTATCGGGATTTATCGGTCGTTTTGGTCCGCTTTGGTCCGCTTGATCGGTTGGCCAAGCCGGCATTCGAAACTCTCCAAAGTGGTTGGCCAACTGCAAACTCGGCGGAAACTCGGCGGCCTGCATTCGGCAGATTGATGGACTGCAGTTGCTCCGCAAAGTTGGCGCCAAAAGTGCCGCCTG

Full Affymetrix probeset data:

Annotations for 1637296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720