FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637298_at:

>probe:Drosophila_2:1637298_at:28:217; Interrogation_Position=1024; Antisense; AAGTTGAGCCAGGATCCCGAGGAGA
>probe:Drosophila_2:1637298_at:218:423; Interrogation_Position=1045; Antisense; GAGAAGAAGCTCATACCAGACGTGT
>probe:Drosophila_2:1637298_at:311:53; Interrogation_Position=1062; Antisense; AGACGTGTACCTGCCCAAGTTGGGA
>probe:Drosophila_2:1637298_at:558:93; Interrogation_Position=1079; Antisense; AGTTGGGAGATCTGTTGCCGTCGAT
>probe:Drosophila_2:1637298_at:550:721; Interrogation_Position=1093; Antisense; TTGCCGTCGATCGTGAACAGCCTGA
>probe:Drosophila_2:1637298_at:536:433; Interrogation_Position=724; Antisense; GAGTGTCTGTTCGTGGCTACCAATA
>probe:Drosophila_2:1637298_at:422:237; Interrogation_Position=744; Antisense; CAATACGGATGAGCGTTTCCCCATG
>probe:Drosophila_2:1637298_at:192:695; Interrogation_Position=759; Antisense; TTTCCCCATGCCCAATATGATAGTA
>probe:Drosophila_2:1637298_at:376:677; Interrogation_Position=779; Antisense; TAGTACCAGGCAGCGGGAGCTTCGT
>probe:Drosophila_2:1637298_at:256:623; Interrogation_Position=803; Antisense; TGCGGGCCATTCAAACCTGTGCGGA
>probe:Drosophila_2:1637298_at:125:369; Interrogation_Position=855; Antisense; GAATCCTGCCATTTGTGAGTCTCTG
>probe:Drosophila_2:1637298_at:694:9; Interrogation_Position=935; Antisense; ATACGGACATACTTCTTGGGTTCAA
>probe:Drosophila_2:1637298_at:14:715; Interrogation_Position=950; Antisense; TTGGGTTCAATTGCGGCTTCCAGAC
>probe:Drosophila_2:1637298_at:121:105; Interrogation_Position=971; Antisense; AGACCCTGCTTGTAGGTTCCGGAAT

Paste this into a BLAST search page for me
AAGTTGAGCCAGGATCCCGAGGAGAGAGAAGAAGCTCATACCAGACGTGTAGACGTGTACCTGCCCAAGTTGGGAAGTTGGGAGATCTGTTGCCGTCGATTTGCCGTCGATCGTGAACAGCCTGAGAGTGTCTGTTCGTGGCTACCAATACAATACGGATGAGCGTTTCCCCATGTTTCCCCATGCCCAATATGATAGTATAGTACCAGGCAGCGGGAGCTTCGTTGCGGGCCATTCAAACCTGTGCGGAGAATCCTGCCATTTGTGAGTCTCTGATACGGACATACTTCTTGGGTTCAATTGGGTTCAATTGCGGCTTCCAGACAGACCCTGCTTGTAGGTTCCGGAAT

Full Affymetrix probeset data:

Annotations for 1637298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720