Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637300_at:

>probe:Drosophila_2:1637300_at:279:359; Interrogation_Position=1148; Antisense; GCAAGGTCAGTCACCACCGTCAACG
>probe:Drosophila_2:1637300_at:455:303; Interrogation_Position=1173; Antisense; CCGCCTGCCGTCAATATTATTATCA
>probe:Drosophila_2:1637300_at:429:15; Interrogation_Position=1188; Antisense; ATTATTATCAGTGTTCCGGAGTTAA
>probe:Drosophila_2:1637300_at:447:367; Interrogation_Position=1219; Antisense; GAATGAACGGCTTGTTTCTAGACGC
>probe:Drosophila_2:1637300_at:160:655; Interrogation_Position=1233; Antisense; TTTCTAGACGCCATTAAACGCCATT
>probe:Drosophila_2:1637300_at:354:663; Interrogation_Position=1247; Antisense; TAAACGCCATTCCACAGAAGCCAAA
>probe:Drosophila_2:1637300_at:402:551; Interrogation_Position=1291; Antisense; GGAGACGCCCTAAGCGACTGGCCAA
>probe:Drosophila_2:1637300_at:95:525; Interrogation_Position=1334; Antisense; GGGCATTCGCACACAGGATGTAATG
>probe:Drosophila_2:1637300_at:679:267; Interrogation_Position=1347; Antisense; CAGGATGTAATGCACTTGATCGAGC
>probe:Drosophila_2:1637300_at:187:727; Interrogation_Position=1362; Antisense; TTGATCGAGCATTTGGAAACCACCA
>probe:Drosophila_2:1637300_at:623:559; Interrogation_Position=1376; Antisense; GGAAACCACCACAGAAGCGAAACTT
>probe:Drosophila_2:1637300_at:698:257; Interrogation_Position=1408; Antisense; CACGGACGTAATAGGCTGGCATTTA
>probe:Drosophila_2:1637300_at:718:571; Interrogation_Position=1421; Antisense; GGCTGGCATTTAGCTTACTCAAGTA
>probe:Drosophila_2:1637300_at:335:611; Interrogation_Position=1465; Antisense; TGAAATAATGCATGAAACCTCCGGA

Paste this into a BLAST search page for me
GCAAGGTCAGTCACCACCGTCAACGCCGCCTGCCGTCAATATTATTATCAATTATTATCAGTGTTCCGGAGTTAAGAATGAACGGCTTGTTTCTAGACGCTTTCTAGACGCCATTAAACGCCATTTAAACGCCATTCCACAGAAGCCAAAGGAGACGCCCTAAGCGACTGGCCAAGGGCATTCGCACACAGGATGTAATGCAGGATGTAATGCACTTGATCGAGCTTGATCGAGCATTTGGAAACCACCAGGAAACCACCACAGAAGCGAAACTTCACGGACGTAATAGGCTGGCATTTAGGCTGGCATTTAGCTTACTCAAGTATGAAATAATGCATGAAACCTCCGGA

Full Affymetrix probeset data:

Annotations for 1637300_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime