Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637304_at:

>probe:Drosophila_2:1637304_at:487:193; Interrogation_Position=160; Antisense; AACTCCGGCGTTTGGACCTGGCTGG
>probe:Drosophila_2:1637304_at:198:573; Interrogation_Position=243; Antisense; GGCGGAGAACCACTATACCCACATG
>probe:Drosophila_2:1637304_at:397:671; Interrogation_Position=258; Antisense; TACCCACATGGACGATGCCTACAGT
>probe:Drosophila_2:1637304_at:49:301; Interrogation_Position=339; Antisense; CGCCAATCCCTCATATCAGAATACG
>probe:Drosophila_2:1637304_at:499:647; Interrogation_Position=354; Antisense; TCAGAATACGGCCTACAGTCAGTGT
>probe:Drosophila_2:1637304_at:554:13; Interrogation_Position=392; Antisense; ATTACCAGGGCCACGAGCAGGACAT
>probe:Drosophila_2:1637304_at:298:73; Interrogation_Position=410; Antisense; AGGACATTCCCATGGTGGTCTCCTC
>probe:Drosophila_2:1637304_at:351:307; Interrogation_Position=440; Antisense; CCAGCAGTGCTTACTATTCGGATCT
>probe:Drosophila_2:1637304_at:185:11; Interrogation_Position=455; Antisense; ATTCGGATCTGTCGGTGACCGCGAT
>probe:Drosophila_2:1637304_at:375:35; Interrogation_Position=503; Antisense; ATCAGGGCGCCTACGAGATTGTCGG
>probe:Drosophila_2:1637304_at:723:405; Interrogation_Position=527; Antisense; GACTGAACGTGATGTCCCAGCCGCT
>probe:Drosophila_2:1637304_at:410:625; Interrogation_Position=551; Antisense; TGCCCAACTGGGATCATCATGGCGG
>probe:Drosophila_2:1637304_at:246:445; Interrogation_Position=678; Antisense; GATGACGCAACGACGAGGTCCTCGA
>probe:Drosophila_2:1637304_at:306:407; Interrogation_Position=701; Antisense; GACTGGCGGCCATCAACGAGACGAG

Paste this into a BLAST search page for me
AACTCCGGCGTTTGGACCTGGCTGGGGCGGAGAACCACTATACCCACATGTACCCACATGGACGATGCCTACAGTCGCCAATCCCTCATATCAGAATACGTCAGAATACGGCCTACAGTCAGTGTATTACCAGGGCCACGAGCAGGACATAGGACATTCCCATGGTGGTCTCCTCCCAGCAGTGCTTACTATTCGGATCTATTCGGATCTGTCGGTGACCGCGATATCAGGGCGCCTACGAGATTGTCGGGACTGAACGTGATGTCCCAGCCGCTTGCCCAACTGGGATCATCATGGCGGGATGACGCAACGACGAGGTCCTCGAGACTGGCGGCCATCAACGAGACGAG

Full Affymetrix probeset data:

Annotations for 1637304_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime