FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637306_at:

>probe:Drosophila_2:1637306_at:241:469; Interrogation_Position=1574; Antisense; GTTGCTGGTTTACGTATGATTCTTT
>probe:Drosophila_2:1637306_at:673:57; Interrogation_Position=1589; Antisense; ATGATTCTTTTGGTTCAGCCAGCTT
>probe:Drosophila_2:1637306_at:546:649; Interrogation_Position=1603; Antisense; TCAGCCAGCTTATTGTTCTTTTCGG
>probe:Drosophila_2:1637306_at:343:471; Interrogation_Position=1617; Antisense; GTTCTTTTCGGGTCCAGTTGGCATA
>probe:Drosophila_2:1637306_at:656:533; Interrogation_Position=1627; Antisense; GGTCCAGTTGGCATACTTTTCATTA
>probe:Drosophila_2:1637306_at:495:191; Interrogation_Position=1654; Antisense; AACTTAGTTCTATTCGTGCTCACAA
>probe:Drosophila_2:1637306_at:547:385; Interrogation_Position=1728; Antisense; GAACAGCGACAAGCCAGTTTTGAAA
>probe:Drosophila_2:1637306_at:68:565; Interrogation_Position=1754; Antisense; GGCGATTCTTTCAGGACAAAACCAG
>probe:Drosophila_2:1637306_at:563:175; Interrogation_Position=1795; Antisense; AAACTGTGTTTCGTAATGGGCATCA
>probe:Drosophila_2:1637306_at:65:65; Interrogation_Position=1810; Antisense; ATGGGCATCACATGGCTGTTGGAAA
>probe:Drosophila_2:1637306_at:323:389; Interrogation_Position=1863; Antisense; GAAAACGTTCTTTTGGACCATCAGC
>probe:Drosophila_2:1637306_at:726:691; Interrogation_Position=1873; Antisense; TTTTGGACCATCAGCGATTCGTTTA
>probe:Drosophila_2:1637306_at:298:327; Interrogation_Position=1886; Antisense; GCGATTCGTTTAATGTGCTACTTGG
>probe:Drosophila_2:1637306_at:12:509; Interrogation_Position=1900; Antisense; GTGCTACTTGGAATCTTTGTCTTCA

Paste this into a BLAST search page for me
GTTGCTGGTTTACGTATGATTCTTTATGATTCTTTTGGTTCAGCCAGCTTTCAGCCAGCTTATTGTTCTTTTCGGGTTCTTTTCGGGTCCAGTTGGCATAGGTCCAGTTGGCATACTTTTCATTAAACTTAGTTCTATTCGTGCTCACAAGAACAGCGACAAGCCAGTTTTGAAAGGCGATTCTTTCAGGACAAAACCAGAAACTGTGTTTCGTAATGGGCATCAATGGGCATCACATGGCTGTTGGAAAGAAAACGTTCTTTTGGACCATCAGCTTTTGGACCATCAGCGATTCGTTTAGCGATTCGTTTAATGTGCTACTTGGGTGCTACTTGGAATCTTTGTCTTCA

Full Affymetrix probeset data:

Annotations for 1637306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720