FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637307_at:

>probe:Drosophila_2:1637307_at:476:365; Interrogation_Position=2103; Antisense; GAATCGTGACAAGCGATCGGCCGTC
>probe:Drosophila_2:1637307_at:334:501; Interrogation_Position=2125; Antisense; GTCGTCACTTAAACCTGTGCTTCAC
>probe:Drosophila_2:1637307_at:639:473; Interrogation_Position=2200; Antisense; GTTAGCCAACTCTGGACTTACTAGT
>probe:Drosophila_2:1637307_at:309:335; Interrogation_Position=2244; Antisense; GCTTGAACCAGGCAAAGCGTCGCCA
>probe:Drosophila_2:1637307_at:22:327; Interrogation_Position=2260; Antisense; GCGTCGCCAAAGCTGAAGAACTAAG
>probe:Drosophila_2:1637307_at:692:13; Interrogation_Position=2332; Antisense; ATTAACCACATGTTGGAGCCATTGT
>probe:Drosophila_2:1637307_at:511:621; Interrogation_Position=2379; Antisense; TGCGTGCACGCACAGTGGTTGTTTA
>probe:Drosophila_2:1637307_at:168:647; Interrogation_Position=2404; Antisense; TCAGTAAGTGCATGGCTGGCTCCAG
>probe:Drosophila_2:1637307_at:35:283; Interrogation_Position=2423; Antisense; CTCCAGCTTGGATCTTATTCTTTGT
>probe:Drosophila_2:1637307_at:117:187; Interrogation_Position=2459; Antisense; AACACTGCGATTGTTACGACTGGCA
>probe:Drosophila_2:1637307_at:376:137; Interrogation_Position=2474; Antisense; ACGACTGGCATTTACGCTTTGCGAT
>probe:Drosophila_2:1637307_at:571:631; Interrogation_Position=2486; Antisense; TACGCTTTGCGATTTGGGTTAACCT
>probe:Drosophila_2:1637307_at:293:541; Interrogation_Position=2502; Antisense; GGTTAACCTCTTTTGTTGTTGATCT
>probe:Drosophila_2:1637307_at:622:25; Interrogation_Position=2552; Antisense; ATAGTCTGCTTTAATGCTGCGAAAA

Paste this into a BLAST search page for me
GAATCGTGACAAGCGATCGGCCGTCGTCGTCACTTAAACCTGTGCTTCACGTTAGCCAACTCTGGACTTACTAGTGCTTGAACCAGGCAAAGCGTCGCCAGCGTCGCCAAAGCTGAAGAACTAAGATTAACCACATGTTGGAGCCATTGTTGCGTGCACGCACAGTGGTTGTTTATCAGTAAGTGCATGGCTGGCTCCAGCTCCAGCTTGGATCTTATTCTTTGTAACACTGCGATTGTTACGACTGGCAACGACTGGCATTTACGCTTTGCGATTACGCTTTGCGATTTGGGTTAACCTGGTTAACCTCTTTTGTTGTTGATCTATAGTCTGCTTTAATGCTGCGAAAA

Full Affymetrix probeset data:

Annotations for 1637307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720