Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637308_at:

>probe:Drosophila_2:1637308_at:564:551; Interrogation_Position=1918; Antisense; GGAGCTTGAGCTACTGCTGGACGAT
>probe:Drosophila_2:1637308_at:608:407; Interrogation_Position=1946; Antisense; GACGGGCGCGACGAGAAGCAACACT
>probe:Drosophila_2:1637308_at:360:377; Interrogation_Position=1960; Antisense; GAAGCAACACTTCAGTCTGACCAAA
>probe:Drosophila_2:1637308_at:382:87; Interrogation_Position=1973; Antisense; AGTCTGACCAAAATCCTCAAGAAGG
>probe:Drosophila_2:1637308_at:690:413; Interrogation_Position=2011; Antisense; GAGCGGTTCAAAGCGAAAGCGTCGT
>probe:Drosophila_2:1637308_at:83:543; Interrogation_Position=2083; Antisense; GGACGACGACTTCCAGGTAAACCTG
>probe:Drosophila_2:1637308_at:706:57; Interrogation_Position=2109; Antisense; ATGATAATCGCTTCAGTGCCGTTTA
>probe:Drosophila_2:1637308_at:468:343; Interrogation_Position=2118; Antisense; GCTTCAGTGCCGTTTACAAGTCGCA
>probe:Drosophila_2:1637308_at:263:219; Interrogation_Position=2135; Antisense; AAGTCGCACGAGTACAACATCGATC
>probe:Drosophila_2:1637308_at:522:309; Interrogation_Position=2181; Antisense; CCACCAAGGGCATGCAGCAGATCAT
>probe:Drosophila_2:1637308_at:679:299; Interrogation_Position=2287; Antisense; CCCCAAGAGGAGTAAGCAGCAGCTG
>probe:Drosophila_2:1637308_at:464:119; Interrogation_Position=2307; Antisense; AGCTGGAGCAGAACGCCCTGGTAAA
>probe:Drosophila_2:1637308_at:237:199; Interrogation_Position=2318; Antisense; AACGCCCTGGTAAAGAGTCTGAAGC
>probe:Drosophila_2:1637308_at:706:265; Interrogation_Position=2363; Antisense; CAGGGCCAGAAGCTTTAGAGGATTA

Paste this into a BLAST search page for me
GGAGCTTGAGCTACTGCTGGACGATGACGGGCGCGACGAGAAGCAACACTGAAGCAACACTTCAGTCTGACCAAAAGTCTGACCAAAATCCTCAAGAAGGGAGCGGTTCAAAGCGAAAGCGTCGTGGACGACGACTTCCAGGTAAACCTGATGATAATCGCTTCAGTGCCGTTTAGCTTCAGTGCCGTTTACAAGTCGCAAAGTCGCACGAGTACAACATCGATCCCACCAAGGGCATGCAGCAGATCATCCCCAAGAGGAGTAAGCAGCAGCTGAGCTGGAGCAGAACGCCCTGGTAAAAACGCCCTGGTAAAGAGTCTGAAGCCAGGGCCAGAAGCTTTAGAGGATTA

Full Affymetrix probeset data:

Annotations for 1637308_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime