Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637314_at:

>probe:Drosophila_2:1637314_at:714:115; Interrogation_Position=1782; Antisense; AGCTCAAACAATGACTCCAGCCTGA
>probe:Drosophila_2:1637314_at:658:283; Interrogation_Position=1803; Antisense; CTGACAACGGTTACTGGCACCAGTG
>probe:Drosophila_2:1637314_at:102:355; Interrogation_Position=1819; Antisense; GCACCAGTGGTGATAACAGCTTTGA
>probe:Drosophila_2:1637314_at:588:341; Interrogation_Position=1837; Antisense; GCTTTGAGCTAACCAACGACTCCAG
>probe:Drosophila_2:1637314_at:86:463; Interrogation_Position=1878; Antisense; GATTACGCTTGCAACATTCCAGACT
>probe:Drosophila_2:1637314_at:500:183; Interrogation_Position=1925; Antisense; AAAAGCACCGACCATCGGCGGAGAT
>probe:Drosophila_2:1637314_at:460:443; Interrogation_Position=1947; Antisense; GATGACATTCCGTTCGATAACTTAT
>probe:Drosophila_2:1637314_at:627:455; Interrogation_Position=1962; Antisense; GATAACTTATGCAACCCAGATGTAT
>probe:Drosophila_2:1637314_at:25:647; Interrogation_Position=1987; Antisense; TCATTTGGCAGCTGGGTGTGGACCT
>probe:Drosophila_2:1637314_at:677:517; Interrogation_Position=2002; Antisense; GTGTGGACCTTCTTATGTTATGCAT
>probe:Drosophila_2:1637314_at:622:215; Interrogation_Position=2045; Antisense; AAGATTCAGTGCACGATTTGTTCAT
>probe:Drosophila_2:1637314_at:197:459; Interrogation_Position=2059; Antisense; GATTTGTTCATATCACGTCTGTAAT
>probe:Drosophila_2:1637314_at:331:135; Interrogation_Position=2216; Antisense; ACGCATAATGGGTTTCTGTGACAGT
>probe:Drosophila_2:1637314_at:182:497; Interrogation_Position=2244; Antisense; GTCTTGGGACAAACTGCGATCTTAT

Paste this into a BLAST search page for me
AGCTCAAACAATGACTCCAGCCTGACTGACAACGGTTACTGGCACCAGTGGCACCAGTGGTGATAACAGCTTTGAGCTTTGAGCTAACCAACGACTCCAGGATTACGCTTGCAACATTCCAGACTAAAAGCACCGACCATCGGCGGAGATGATGACATTCCGTTCGATAACTTATGATAACTTATGCAACCCAGATGTATTCATTTGGCAGCTGGGTGTGGACCTGTGTGGACCTTCTTATGTTATGCATAAGATTCAGTGCACGATTTGTTCATGATTTGTTCATATCACGTCTGTAATACGCATAATGGGTTTCTGTGACAGTGTCTTGGGACAAACTGCGATCTTAT

Full Affymetrix probeset data:

Annotations for 1637314_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime