FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637315_at:

>probe:Drosophila_2:1637315_at:86:249; Interrogation_Position=263; Antisense; CAATCGTCGGCAGCGTTAGCCTAGC
>probe:Drosophila_2:1637315_at:295:705; Interrogation_Position=278; Antisense; TTAGCCTAGCCCAGACGGGTGAGAA
>probe:Drosophila_2:1637315_at:184:519; Interrogation_Position=320; Antisense; GTGGAGATAACACCGCCGAGAACTC
>probe:Drosophila_2:1637315_at:162:385; Interrogation_Position=339; Antisense; GAACTCATCGGAATTGGACGACAAC
>probe:Drosophila_2:1637315_at:161:183; Interrogation_Position=361; Antisense; AACAACGACTTCGTGCCGGTACTAT
>probe:Drosophila_2:1637315_at:235:33; Interrogation_Position=389; Antisense; ATCACCGCCGCGATCGCAAAAAGGC
>probe:Drosophila_2:1637315_at:412:441; Interrogation_Position=460; Antisense; GATGGTCAGAAACCCCAGCAGGCTG
>probe:Drosophila_2:1637315_at:20:545; Interrogation_Position=502; Antisense; GGATCCTCCGACACCGAACGCAAGT
>probe:Drosophila_2:1637315_at:671:381; Interrogation_Position=517; Antisense; GAACGCAAGTCAGTGCGCCCACGTG
>probe:Drosophila_2:1637315_at:308:679; Interrogation_Position=555; Antisense; TAGTCCCCGCAAATCGGCAGCTGGA
>probe:Drosophila_2:1637315_at:320:447; Interrogation_Position=596; Antisense; GATCCAATGCTGGAGCTGTGTCCTC
>probe:Drosophila_2:1637315_at:87:471; Interrogation_Position=625; Antisense; GTTCCTGGTGGACCGAAAGTACACA
>probe:Drosophila_2:1637315_at:689:223; Interrogation_Position=649; Antisense; AAGGATCGCAAGGATACCTCGCCCA
>probe:Drosophila_2:1637315_at:417:297; Interrogation_Position=800; Antisense; CGCCCAAGGTCAACGCATGGAAGGT

Paste this into a BLAST search page for me
CAATCGTCGGCAGCGTTAGCCTAGCTTAGCCTAGCCCAGACGGGTGAGAAGTGGAGATAACACCGCCGAGAACTCGAACTCATCGGAATTGGACGACAACAACAACGACTTCGTGCCGGTACTATATCACCGCCGCGATCGCAAAAAGGCGATGGTCAGAAACCCCAGCAGGCTGGGATCCTCCGACACCGAACGCAAGTGAACGCAAGTCAGTGCGCCCACGTGTAGTCCCCGCAAATCGGCAGCTGGAGATCCAATGCTGGAGCTGTGTCCTCGTTCCTGGTGGACCGAAAGTACACAAAGGATCGCAAGGATACCTCGCCCACGCCCAAGGTCAACGCATGGAAGGT

Full Affymetrix probeset data:

Annotations for 1637315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720