FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637316_at:

>probe:Drosophila_2:1637316_at:538:391; Interrogation_Position=105; Antisense; GAAAGTCGTTCGGAATGCCACCCTT
>probe:Drosophila_2:1637316_at:401:683; Interrogation_Position=213; Antisense; TATACACCACGACCGCGGAGTATGA
>probe:Drosophila_2:1637316_at:571:429; Interrogation_Position=230; Antisense; GAGTATGAACGACCATTGTCCCTGA
>probe:Drosophila_2:1637316_at:506:5; Interrogation_Position=244; Antisense; ATTGTCCCTGAAGTTTTATGCCCGC
>probe:Drosophila_2:1637316_at:351:137; Interrogation_Position=270; Antisense; ACGACTGGCCCTATTTTAATTGCAC
>probe:Drosophila_2:1637316_at:372:533; Interrogation_Position=304; Antisense; GGTGCAACGCATACGGGAGAAACTT
>probe:Drosophila_2:1637316_at:590:551; Interrogation_Position=319; Antisense; GGAGAAACTTGACCCGGTGTCACTG
>probe:Drosophila_2:1637316_at:575:533; Interrogation_Position=334; Antisense; GGTGTCACTGCAGAACGCGCGTAAA
>probe:Drosophila_2:1637316_at:319:135; Interrogation_Position=348; Antisense; ACGCGCGTAAAATTATCAGCCTGGA
>probe:Drosophila_2:1637316_at:590:425; Interrogation_Position=395; Antisense; GAGATGAAGCACAACACGCCGCAGC
>probe:Drosophila_2:1637316_at:62:353; Interrogation_Position=415; Antisense; GCAGCCCATGACTGTCAACCAGATA
>probe:Drosophila_2:1637316_at:474:61; Interrogation_Position=445; Antisense; ATGGTACTCGGATAGAGCCCACCGC
>probe:Drosophila_2:1637316_at:228:693; Interrogation_Position=500; Antisense; TTTCCTCACGAGAACGATCCCATGA
>probe:Drosophila_2:1637316_at:416:199; Interrogation_Position=552; Antisense; AACGCTCTTAAAGTTTCCATCTTGT

Paste this into a BLAST search page for me
GAAAGTCGTTCGGAATGCCACCCTTTATACACCACGACCGCGGAGTATGAGAGTATGAACGACCATTGTCCCTGAATTGTCCCTGAAGTTTTATGCCCGCACGACTGGCCCTATTTTAATTGCACGGTGCAACGCATACGGGAGAAACTTGGAGAAACTTGACCCGGTGTCACTGGGTGTCACTGCAGAACGCGCGTAAAACGCGCGTAAAATTATCAGCCTGGAGAGATGAAGCACAACACGCCGCAGCGCAGCCCATGACTGTCAACCAGATAATGGTACTCGGATAGAGCCCACCGCTTTCCTCACGAGAACGATCCCATGAAACGCTCTTAAAGTTTCCATCTTGT

Full Affymetrix probeset data:

Annotations for 1637316_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720