FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637317_at:

>probe:Drosophila_2:1637317_at:311:667; Interrogation_Position=1012; Antisense; TACTTGGACCAACTGCCAGAGACGC
>probe:Drosophila_2:1637317_at:432:269; Interrogation_Position=1051; Antisense; CATCCGGCTATCTATATACGCTATC
>probe:Drosophila_2:1637317_at:198:27; Interrogation_Position=1066; Antisense; ATACGCTATCCCACGGACCAGGAAA
>probe:Drosophila_2:1637317_at:181:281; Interrogation_Position=1168; Antisense; CTCTTTCAATTTTATGCGCGCATCT
>probe:Drosophila_2:1637317_at:246:273; Interrogation_Position=675; Antisense; CATTCGTCTATTCCCCAACAAAGAA
>probe:Drosophila_2:1637317_at:75:211; Interrogation_Position=695; Antisense; AAGAAGGCTACGTGATGTCCTCCAT
>probe:Drosophila_2:1637317_at:112:83; Interrogation_Position=735; Antisense; AGTGGAGTACCTGGATCACGATCCT
>probe:Drosophila_2:1637317_at:224:139; Interrogation_Position=752; Antisense; ACGATCCTGAGGTGCAGCGCCGCAA
>probe:Drosophila_2:1637317_at:724:215; Interrogation_Position=775; Antisense; AAGTTCGCTTTCAAGTGCCACCGGA
>probe:Drosophila_2:1637317_at:575:95; Interrogation_Position=821; Antisense; AGATCTACCCCGTTAATGCCTTGAG
>probe:Drosophila_2:1637317_at:548:49; Interrogation_Position=836; Antisense; ATGCCTTGAGTTTCCACAATGTCTA
>probe:Drosophila_2:1637317_at:217:229; Interrogation_Position=853; Antisense; AATGTCTATCAGACGTTCGCCACTG
>probe:Drosophila_2:1637317_at:443:159; Interrogation_Position=917; Antisense; ACAAGAAGCGCCTTTGTCAGTTCCA
>probe:Drosophila_2:1637317_at:54:469; Interrogation_Position=936; Antisense; GTTCCACGAATACGATACCTCCATA

Paste this into a BLAST search page for me
TACTTGGACCAACTGCCAGAGACGCCATCCGGCTATCTATATACGCTATCATACGCTATCCCACGGACCAGGAAACTCTTTCAATTTTATGCGCGCATCTCATTCGTCTATTCCCCAACAAAGAAAAGAAGGCTACGTGATGTCCTCCATAGTGGAGTACCTGGATCACGATCCTACGATCCTGAGGTGCAGCGCCGCAAAAGTTCGCTTTCAAGTGCCACCGGAAGATCTACCCCGTTAATGCCTTGAGATGCCTTGAGTTTCCACAATGTCTAAATGTCTATCAGACGTTCGCCACTGACAAGAAGCGCCTTTGTCAGTTCCAGTTCCACGAATACGATACCTCCATA

Full Affymetrix probeset data:

Annotations for 1637317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720