FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637318_at:

>probe:Drosophila_2:1637318_at:207:111; Interrogation_Position=162; Antisense; AGCACCCTACTGTACGAATCTCAAG
>probe:Drosophila_2:1637318_at:559:179; Interrogation_Position=193; Antisense; AAACACATTTTTGCGTTGCCCATAC
>probe:Drosophila_2:1637318_at:317:279; Interrogation_Position=20; Antisense; CTCAATGCCAGAGACCAGGCCAGAA
>probe:Drosophila_2:1637318_at:258:695; Interrogation_Position=202; Antisense; TTTGCGTTGCCCATACTTTTCAAGG
>probe:Drosophila_2:1637318_at:265:561; Interrogation_Position=230; Antisense; GGAAGAAAACCCTTGAGCCCACTGA
>probe:Drosophila_2:1637318_at:44:727; Interrogation_Position=242; Antisense; TTGAGCCCACTGATCTATATAATGC
>probe:Drosophila_2:1637318_at:361:257; Interrogation_Position=277; Antisense; CACAAAGCGGAAACTCTCGGTGACA
>probe:Drosophila_2:1637318_at:695:511; Interrogation_Position=296; Antisense; GTGACAAATTCTTCGCGACCTGGCA
>probe:Drosophila_2:1637318_at:570:131; Interrogation_Position=313; Antisense; ACCTGGCAGTCGGAAGTCAGATCCT
>probe:Drosophila_2:1637318_at:38:79; Interrogation_Position=386; Antisense; AGGTATTCGGATGGCAGCTTTTCCT
>probe:Drosophila_2:1637318_at:643:115; Interrogation_Position=401; Antisense; AGCTTTTCCTGTCTGGCATAGTTGT
>probe:Drosophila_2:1637318_at:487:569; Interrogation_Position=415; Antisense; GGCATAGTTGTTGGAGTTCTCGAGC
>probe:Drosophila_2:1637318_at:374:173; Interrogation_Position=45; Antisense; AAAGCAAACTCCACTGGCTCTGAAT
>probe:Drosophila_2:1637318_at:286:285; Interrogation_Position=64; Antisense; CTGAATCTGGCTCTCAATCTGAATT

Paste this into a BLAST search page for me
AGCACCCTACTGTACGAATCTCAAGAAACACATTTTTGCGTTGCCCATACCTCAATGCCAGAGACCAGGCCAGAATTTGCGTTGCCCATACTTTTCAAGGGGAAGAAAACCCTTGAGCCCACTGATTGAGCCCACTGATCTATATAATGCCACAAAGCGGAAACTCTCGGTGACAGTGACAAATTCTTCGCGACCTGGCAACCTGGCAGTCGGAAGTCAGATCCTAGGTATTCGGATGGCAGCTTTTCCTAGCTTTTCCTGTCTGGCATAGTTGTGGCATAGTTGTTGGAGTTCTCGAGCAAAGCAAACTCCACTGGCTCTGAATCTGAATCTGGCTCTCAATCTGAATT

Full Affymetrix probeset data:

Annotations for 1637318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720