FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637319_at:

>probe:Drosophila_2:1637319_at:296:497; Interrogation_Position=1031; Antisense; GTCTCCTGCGACAATGCCAAATGTG
>probe:Drosophila_2:1637319_at:505:63; Interrogation_Position=1051; Antisense; ATGTGTGCTAAAGTGCCATGCCGTC
>probe:Drosophila_2:1637319_at:262:627; Interrogation_Position=1064; Antisense; TGCCATGCCGTCTGTTTGGAGGAGT
>probe:Drosophila_2:1637319_at:12:441; Interrogation_Position=1102; Antisense; GATGGATGGCAAGACCTTTCTGGAG
>probe:Drosophila_2:1637319_at:185:227; Interrogation_Position=1154; Antisense; AAGGCGAAGCTGTCCACCTCATTTG
>probe:Drosophila_2:1637319_at:664:189; Interrogation_Position=647; Antisense; AACTTCATGGATATCGACGAGCTTT
>probe:Drosophila_2:1637319_at:514:419; Interrogation_Position=665; Antisense; GAGCTTTGTCATGTGCTGCAACCAT
>probe:Drosophila_2:1637319_at:728:223; Interrogation_Position=731; Antisense; AAGGATCGCGTCTACTTGAAGCTGA
>probe:Drosophila_2:1637319_at:85:669; Interrogation_Position=743; Antisense; TACTTGAAGCTGACCATCGCGGATC
>probe:Drosophila_2:1637319_at:489:281; Interrogation_Position=775; Antisense; CTGCATTGCATCCATGTCGCTAAAG
>probe:Drosophila_2:1637319_at:539:295; Interrogation_Position=792; Antisense; CGCTAAAGATCATTGGGCCCACGGA
>probe:Drosophila_2:1637319_at:567:259; Interrogation_Position=836; Antisense; CACGTTCTCAGCGATGGTCTAAGTA
>probe:Drosophila_2:1637319_at:420:229; Interrogation_Position=901; Antisense; AATGTTCGACTTGTGCTACTTTCCC
>probe:Drosophila_2:1637319_at:142:625; Interrogation_Position=978; Antisense; TGCGCTGTAACATTTGCTTTGCCTA

Paste this into a BLAST search page for me
GTCTCCTGCGACAATGCCAAATGTGATGTGTGCTAAAGTGCCATGCCGTCTGCCATGCCGTCTGTTTGGAGGAGTGATGGATGGCAAGACCTTTCTGGAGAAGGCGAAGCTGTCCACCTCATTTGAACTTCATGGATATCGACGAGCTTTGAGCTTTGTCATGTGCTGCAACCATAAGGATCGCGTCTACTTGAAGCTGATACTTGAAGCTGACCATCGCGGATCCTGCATTGCATCCATGTCGCTAAAGCGCTAAAGATCATTGGGCCCACGGACACGTTCTCAGCGATGGTCTAAGTAAATGTTCGACTTGTGCTACTTTCCCTGCGCTGTAACATTTGCTTTGCCTA

Full Affymetrix probeset data:

Annotations for 1637319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720