FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637320_at:

>probe:Drosophila_2:1637320_at:183:691; Interrogation_Position=1039; Antisense; TTTGAGCCAGATAATGCCATTGCCA
>probe:Drosophila_2:1637320_at:350:631; Interrogation_Position=1111; Antisense; TCCTCTGCCACACGTTTGATAATTG
>probe:Drosophila_2:1637320_at:526:427; Interrogation_Position=1138; Antisense; GAGATCGATCCTCCGCAACTGAAGA
>probe:Drosophila_2:1637320_at:86:381; Interrogation_Position=1219; Antisense; GAACCAGTTGTCTCGGCAAAGAAGC
>probe:Drosophila_2:1637320_at:274:453; Interrogation_Position=1264; Antisense; GATCTAGCCGAGTTGGTCAAGCCGA
>probe:Drosophila_2:1637320_at:507:183; Interrogation_Position=1300; Antisense; AAAAGTAACTTGGTGTCAGCCGCAG
>probe:Drosophila_2:1637320_at:380:495; Interrogation_Position=1314; Antisense; GTCAGCCGCAGAAGCCTTGGGAAAT
>probe:Drosophila_2:1637320_at:317:211; Interrogation_Position=1369; Antisense; AAGAAGCCACAAAGTCCTCCTATGA
>probe:Drosophila_2:1637320_at:356:175; Interrogation_Position=1403; Antisense; AAACCTTACTGCGTTTGCCACAGGA
>probe:Drosophila_2:1637320_at:521:333; Interrogation_Position=871; Antisense; GCTGTCGCTCATCTCAAGTTGAAGA
>probe:Drosophila_2:1637320_at:11:31; Interrogation_Position=897; Antisense; ATACTTTTCGGCCATATCGGACTGC
>probe:Drosophila_2:1637320_at:454:203; Interrogation_Position=923; Antisense; AAGCCTGTCTGCAGATCGATCCAAT
>probe:Drosophila_2:1637320_at:575:657; Interrogation_Position=954; Antisense; TAAGGCACACCTTCGAATGGCTGAG
>probe:Drosophila_2:1637320_at:692:67; Interrogation_Position=970; Antisense; ATGGCTGAGGCCCACAATGCCGAAG

Paste this into a BLAST search page for me
TTTGAGCCAGATAATGCCATTGCCATCCTCTGCCACACGTTTGATAATTGGAGATCGATCCTCCGCAACTGAAGAGAACCAGTTGTCTCGGCAAAGAAGCGATCTAGCCGAGTTGGTCAAGCCGAAAAAGTAACTTGGTGTCAGCCGCAGGTCAGCCGCAGAAGCCTTGGGAAATAAGAAGCCACAAAGTCCTCCTATGAAAACCTTACTGCGTTTGCCACAGGAGCTGTCGCTCATCTCAAGTTGAAGAATACTTTTCGGCCATATCGGACTGCAAGCCTGTCTGCAGATCGATCCAATTAAGGCACACCTTCGAATGGCTGAGATGGCTGAGGCCCACAATGCCGAAG

Full Affymetrix probeset data:

Annotations for 1637320_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720