FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637321_at:

>probe:Drosophila_2:1637321_at:619:385; Interrogation_Position=1947; Antisense; GAACACTAAACGATACTTGCTTGAG
>probe:Drosophila_2:1637321_at:350:273; Interrogation_Position=1962; Antisense; CTTGCTTGAGCAGAATTAACACCTA
>probe:Drosophila_2:1637321_at:288:387; Interrogation_Position=2037; Antisense; GAACACACACTAAGCAGACGTCGAG
>probe:Drosophila_2:1637321_at:217:173; Interrogation_Position=2125; Antisense; AAACCAACCTAGTGGAATTGTGAGT
>probe:Drosophila_2:1637321_at:221:199; Interrogation_Position=2167; Antisense; AACGAACTTAGCTAATATGGACATC
>probe:Drosophila_2:1637321_at:428:19; Interrogation_Position=2246; Antisense; ATTTGTTATGTTGTGCCAGGAACTT
>probe:Drosophila_2:1637321_at:527:217; Interrogation_Position=2277; Antisense; AAGTAATCGCAGTTTTACGCATAAG
>probe:Drosophila_2:1637321_at:592:369; Interrogation_Position=2308; Antisense; GAATGGAATACATCCCGAATCAATT
>probe:Drosophila_2:1637321_at:505:489; Interrogation_Position=2334; Antisense; GTAAATGCTTCTCACACGATCGCAG
>probe:Drosophila_2:1637321_at:610:713; Interrogation_Position=2342; Antisense; TTCTCACACGATCGCAGCTAGCAAA
>probe:Drosophila_2:1637321_at:255:85; Interrogation_Position=2368; Antisense; AGATCGACTTAATCGTAGGCTCCGA
>probe:Drosophila_2:1637321_at:216:43; Interrogation_Position=2379; Antisense; ATCGTAGGCTCCGAAGATCCGAAGA
>probe:Drosophila_2:1637321_at:480:95; Interrogation_Position=2393; Antisense; AGATCCGAAGATCCGGAGACCCGGA
>probe:Drosophila_2:1637321_at:19:413; Interrogation_Position=2410; Antisense; GACCCGGAGCCTACATGAAACCAAT

Paste this into a BLAST search page for me
GAACACTAAACGATACTTGCTTGAGCTTGCTTGAGCAGAATTAACACCTAGAACACACACTAAGCAGACGTCGAGAAACCAACCTAGTGGAATTGTGAGTAACGAACTTAGCTAATATGGACATCATTTGTTATGTTGTGCCAGGAACTTAAGTAATCGCAGTTTTACGCATAAGGAATGGAATACATCCCGAATCAATTGTAAATGCTTCTCACACGATCGCAGTTCTCACACGATCGCAGCTAGCAAAAGATCGACTTAATCGTAGGCTCCGAATCGTAGGCTCCGAAGATCCGAAGAAGATCCGAAGATCCGGAGACCCGGAGACCCGGAGCCTACATGAAACCAAT

Full Affymetrix probeset data:

Annotations for 1637321_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720