Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637325_at:

>probe:Drosophila_2:1637325_at:72:43; Interrogation_Position=100; Antisense; ATCGTCATCGGTGCCAAGAAGCCAG
>probe:Drosophila_2:1637325_at:407:211; Interrogation_Position=115; Antisense; AAGAAGCCAGGAGCTGCACCTGCCG
>probe:Drosophila_2:1637325_at:306:51; Interrogation_Position=13; Antisense; ATGAAGTTCCTAGCTCTTTTCGTCA
>probe:Drosophila_2:1637325_at:447:337; Interrogation_Position=190; Antisense; GCTCCAGCTGCTCCTGAAGCAGGAC
>probe:Drosophila_2:1637325_at:705:207; Interrogation_Position=206; Antisense; AAGCAGGACTCGCAGATGCTCCAGC
>probe:Drosophila_2:1637325_at:262:447; Interrogation_Position=220; Antisense; GATGCTCCAGCCGAAAGTTAAATAT
>probe:Drosophila_2:1637325_at:33:677; Interrogation_Position=23; Antisense; TAGCTCTTTTCGTCACTTTGCTGGT
>probe:Drosophila_2:1637325_at:456:57; Interrogation_Position=246; Antisense; ATGAGTCAGAGGTTATTTTCTTCTA
>probe:Drosophila_2:1637325_at:584:711; Interrogation_Position=263; Antisense; TTCTTCTAATAAAATGGATCGCTAA
>probe:Drosophila_2:1637325_at:112:547; Interrogation_Position=278; Antisense; GGATCGCTAATCACAATATATGTTT
>probe:Drosophila_2:1637325_at:263:495; Interrogation_Position=34; Antisense; GTCACTTTGCTGGTTGTTCTGGCTT
>probe:Drosophila_2:1637325_at:176:603; Interrogation_Position=48; Antisense; TGTTCTGGCTTTGGTTAGCGCCCAA
>probe:Drosophila_2:1637325_at:454:539; Interrogation_Position=60; Antisense; GGTTAGCGCCCAAAAGAGCCAGAAT
>probe:Drosophila_2:1637325_at:14:367; Interrogation_Position=81; Antisense; GAATACAAATCACAACGTCATCGTC

Paste this into a BLAST search page for me
ATCGTCATCGGTGCCAAGAAGCCAGAAGAAGCCAGGAGCTGCACCTGCCGATGAAGTTCCTAGCTCTTTTCGTCAGCTCCAGCTGCTCCTGAAGCAGGACAAGCAGGACTCGCAGATGCTCCAGCGATGCTCCAGCCGAAAGTTAAATATTAGCTCTTTTCGTCACTTTGCTGGTATGAGTCAGAGGTTATTTTCTTCTATTCTTCTAATAAAATGGATCGCTAAGGATCGCTAATCACAATATATGTTTGTCACTTTGCTGGTTGTTCTGGCTTTGTTCTGGCTTTGGTTAGCGCCCAAGGTTAGCGCCCAAAAGAGCCAGAATGAATACAAATCACAACGTCATCGTC

Full Affymetrix probeset data:

Annotations for 1637325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime