FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637326_at:

>probe:Drosophila_2:1637326_at:104:165; Interrogation_Position=1002; Antisense; AAATACCTTTCTGCGACGTGGCTGT
>probe:Drosophila_2:1637326_at:450:171; Interrogation_Position=1061; Antisense; AAAGTTGCCAATTGTGCCGCGATGC
>probe:Drosophila_2:1637326_at:69:447; Interrogation_Position=1081; Antisense; GATGCGGATGGCTGCAATCGCTACT
>probe:Drosophila_2:1637326_at:284:487; Interrogation_Position=1112; Antisense; GTAGCTGTTACCGTTGCAATGCCCA
>probe:Drosophila_2:1637326_at:598:233; Interrogation_Position=1129; Antisense; AATGCCCAGGACCAGGATTCGGACT
>probe:Drosophila_2:1637326_at:302:463; Interrogation_Position=1144; Antisense; GATTCGGACTGTGCGGCCATGGATC
>probe:Drosophila_2:1637326_at:123:199; Interrogation_Position=1176; Antisense; AACGATGACGACCAGCAATTGCTCT
>probe:Drosophila_2:1637326_at:56:409; Interrogation_Position=1243; Antisense; GACGGTATCTACACGGTGCGCGGAT
>probe:Drosophila_2:1637326_at:459:549; Interrogation_Position=1284; Antisense; GGAGTGTTCCGCCAATGATCCGTAC
>probe:Drosophila_2:1637326_at:102:231; Interrogation_Position=1297; Antisense; AATGATCCGTACTGTGTCCGCTGCA
>probe:Drosophila_2:1637326_at:651:679; Interrogation_Position=1380; Antisense; TATGGATCAGCAGTTGCCGCCTAGC
>probe:Drosophila_2:1637326_at:99:675; Interrogation_Position=1401; Antisense; TAGCTGGTGGTCACTGCTGCAGTAC
>probe:Drosophila_2:1637326_at:270:507; Interrogation_Position=899; Antisense; GTGCTGGCCGCAATTTACCAACGGA
>probe:Drosophila_2:1637326_at:141:689; Interrogation_Position=952; Antisense; TATTCCTGCGAGCAAGATACCCTTG

Paste this into a BLAST search page for me
AAATACCTTTCTGCGACGTGGCTGTAAAGTTGCCAATTGTGCCGCGATGCGATGCGGATGGCTGCAATCGCTACTGTAGCTGTTACCGTTGCAATGCCCAAATGCCCAGGACCAGGATTCGGACTGATTCGGACTGTGCGGCCATGGATCAACGATGACGACCAGCAATTGCTCTGACGGTATCTACACGGTGCGCGGATGGAGTGTTCCGCCAATGATCCGTACAATGATCCGTACTGTGTCCGCTGCATATGGATCAGCAGTTGCCGCCTAGCTAGCTGGTGGTCACTGCTGCAGTACGTGCTGGCCGCAATTTACCAACGGATATTCCTGCGAGCAAGATACCCTTG

Full Affymetrix probeset data:

Annotations for 1637326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720