Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637327_at:

>probe:Drosophila_2:1637327_at:375:179; Interrogation_Position=5907; Antisense; AAACATTGGAATTGGCAGCTGCCAC
>probe:Drosophila_2:1637327_at:640:669; Interrogation_Position=5970; Antisense; TACTGCAGGGATGTATTGGAACCAC
>probe:Drosophila_2:1637327_at:540:377; Interrogation_Position=5988; Antisense; GAACCACTGTTAACCAAGGACCGAT
>probe:Drosophila_2:1637327_at:185:167; Interrogation_Position=6015; Antisense; AAATGGCGAGTGTGTTCCTTTCCAA
>probe:Drosophila_2:1637327_at:609:601; Interrogation_Position=6027; Antisense; TGTTCCTTTCCAATTTATCCGACGG
>probe:Drosophila_2:1637327_at:560:159; Interrogation_Position=6078; Antisense; ACAAACTTCGGTTGTGCTTTCGCGA
>probe:Drosophila_2:1637327_at:81:275; Interrogation_Position=6094; Antisense; CTTTCGCGAGTTTTCAAAGCGTTGT
>probe:Drosophila_2:1637327_at:661:135; Interrogation_Position=6187; Antisense; ACGTAACAACGATCGGTTCATTGAA
>probe:Drosophila_2:1637327_at:393:473; Interrogation_Position=6202; Antisense; GTTCATTGAACGATTGACTCCCTTT
>probe:Drosophila_2:1637327_at:203:145; Interrogation_Position=6218; Antisense; ACTCCCTTTATTACTCTTACATCAG
>probe:Drosophila_2:1637327_at:146:265; Interrogation_Position=6240; Antisense; CAGTTCAGAATCATGGCGTTGTCAA
>probe:Drosophila_2:1637327_at:646:597; Interrogation_Position=6259; Antisense; TGTCAAGGCCAACGCGTACAACAAC
>probe:Drosophila_2:1637327_at:683:63; Interrogation_Position=6301; Antisense; ATGGTAACTTCTTGCACACGACTTA
>probe:Drosophila_2:1637327_at:373:537; Interrogation_Position=6352; Antisense; GGTCTTTCATGTCTAGCGTATCGGA

Paste this into a BLAST search page for me
AAACATTGGAATTGGCAGCTGCCACTACTGCAGGGATGTATTGGAACCACGAACCACTGTTAACCAAGGACCGATAAATGGCGAGTGTGTTCCTTTCCAATGTTCCTTTCCAATTTATCCGACGGACAAACTTCGGTTGTGCTTTCGCGACTTTCGCGAGTTTTCAAAGCGTTGTACGTAACAACGATCGGTTCATTGAAGTTCATTGAACGATTGACTCCCTTTACTCCCTTTATTACTCTTACATCAGCAGTTCAGAATCATGGCGTTGTCAATGTCAAGGCCAACGCGTACAACAACATGGTAACTTCTTGCACACGACTTAGGTCTTTCATGTCTAGCGTATCGGA

Full Affymetrix probeset data:

Annotations for 1637327_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime