FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637328_at:

>probe:Drosophila_2:1637328_at:634:527; Interrogation_Position=1502; Antisense; GGGACAACAGCGTGCTATCCGCCGT
>probe:Drosophila_2:1637328_at:329:375; Interrogation_Position=1528; Antisense; GAAGACTCCTCGACGATAACCTCGC
>probe:Drosophila_2:1637328_at:252:115; Interrogation_Position=1573; Antisense; AGCTTGGAGGCTCCCCAGGTGACAC
>probe:Drosophila_2:1637328_at:561:255; Interrogation_Position=1588; Antisense; CAGGTGACACCGAGCGTCCAAAGCT
>probe:Drosophila_2:1637328_at:729:523; Interrogation_Position=1635; Antisense; GGGCAGCCACTGTTGAACGGACCAC
>probe:Drosophila_2:1637328_at:365:553; Interrogation_Position=1723; Antisense; GGAGCTGCGCAAGATGACGGCATTC
>probe:Drosophila_2:1637328_at:145:55; Interrogation_Position=1736; Antisense; ATGACGGCATTCAAGGCTCGTCCGA
>probe:Drosophila_2:1637328_at:288:69; Interrogation_Position=1749; Antisense; AGGCTCGTCCGAATCCATTTAAATA
>probe:Drosophila_2:1637328_at:21:663; Interrogation_Position=1768; Antisense; TAAATAGTGCTCGACGGAACCAATC
>probe:Drosophila_2:1637328_at:40:379; Interrogation_Position=1784; Antisense; GAACCAATCGACTACCAAACGTTTG
>probe:Drosophila_2:1637328_at:231:177; Interrogation_Position=1800; Antisense; AAACGTTTGATAGCCCTGTCCAAAT
>probe:Drosophila_2:1637328_at:599:477; Interrogation_Position=1860; Antisense; GTTTACCGATGCATAGTTTTACCAG
>probe:Drosophila_2:1637328_at:81:687; Interrogation_Position=1930; Antisense; TATATCGTTCCCGTTTTTGGCGGAT
>probe:Drosophila_2:1637328_at:671:361; Interrogation_Position=2025; Antisense; GCAATTGCGATCATTAACTGTTTTC

Paste this into a BLAST search page for me
GGGACAACAGCGTGCTATCCGCCGTGAAGACTCCTCGACGATAACCTCGCAGCTTGGAGGCTCCCCAGGTGACACCAGGTGACACCGAGCGTCCAAAGCTGGGCAGCCACTGTTGAACGGACCACGGAGCTGCGCAAGATGACGGCATTCATGACGGCATTCAAGGCTCGTCCGAAGGCTCGTCCGAATCCATTTAAATATAAATAGTGCTCGACGGAACCAATCGAACCAATCGACTACCAAACGTTTGAAACGTTTGATAGCCCTGTCCAAATGTTTACCGATGCATAGTTTTACCAGTATATCGTTCCCGTTTTTGGCGGATGCAATTGCGATCATTAACTGTTTTC

Full Affymetrix probeset data:

Annotations for 1637328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720