FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637332_at:

>probe:Drosophila_2:1637332_at:500:531; Interrogation_Position=1011; Antisense; GGTGTGGCCACCGTTGGACGACTTA
>probe:Drosophila_2:1637332_at:375:587; Interrogation_Position=1025; Antisense; TGGACGACTTACTACACTGCTGTGG
>probe:Drosophila_2:1637332_at:194:595; Interrogation_Position=1045; Antisense; TGTGGGAGTCCCAGCATCGCGACTG
>probe:Drosophila_2:1637332_at:327:177; Interrogation_Position=1083; Antisense; AAACTGGTTTGGAAGGCACTGGAGA
>probe:Drosophila_2:1637332_at:10:199; Interrogation_Position=1167; Antisense; AACGATGCATTCAAAGTGGCCCCTT
>probe:Drosophila_2:1637332_at:539:649; Interrogation_Position=1177; Antisense; TCAAAGTGGCCCCTTGATGTCCAAG
>probe:Drosophila_2:1637332_at:640:61; Interrogation_Position=1193; Antisense; ATGTCCAAGCCAGCCGGATGGTGAA
>probe:Drosophila_2:1637332_at:244:277; Interrogation_Position=1242; Antisense; CTTTTGCTAAATTCAGAGCGGCCTT
>probe:Drosophila_2:1637332_at:682:417; Interrogation_Position=1257; Antisense; GAGCGGCCTTTGACAGAAGACATCG
>probe:Drosophila_2:1637332_at:244:197; Interrogation_Position=1335; Antisense; AATCCAACCTATCGAATAAGTGCGT
>probe:Drosophila_2:1637332_at:656:371; Interrogation_Position=909; Antisense; GAAGGACAGATCGACCAGGCCATAA
>probe:Drosophila_2:1637332_at:660:413; Interrogation_Position=921; Antisense; GACCAGGCCATAATCGATCACCAAA
>probe:Drosophila_2:1637332_at:417:513; Interrogation_Position=966; Antisense; GTGATATACCAGCTGTTGCTCCAGT
>probe:Drosophila_2:1637332_at:677:723; Interrogation_Position=981; Antisense; TTGCTCCAGTGGATTCGAAGCTCGG

Paste this into a BLAST search page for me
GGTGTGGCCACCGTTGGACGACTTATGGACGACTTACTACACTGCTGTGGTGTGGGAGTCCCAGCATCGCGACTGAAACTGGTTTGGAAGGCACTGGAGAAACGATGCATTCAAAGTGGCCCCTTTCAAAGTGGCCCCTTGATGTCCAAGATGTCCAAGCCAGCCGGATGGTGAACTTTTGCTAAATTCAGAGCGGCCTTGAGCGGCCTTTGACAGAAGACATCGAATCCAACCTATCGAATAAGTGCGTGAAGGACAGATCGACCAGGCCATAAGACCAGGCCATAATCGATCACCAAAGTGATATACCAGCTGTTGCTCCAGTTTGCTCCAGTGGATTCGAAGCTCGG

Full Affymetrix probeset data:

Annotations for 1637332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720