FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637333_at:

>probe:Drosophila_2:1637333_at:511:435; Interrogation_Position=1035; Antisense; GAGGTGCTTTCACGGCAAGAGCTTA
>probe:Drosophila_2:1637333_at:329:343; Interrogation_Position=1055; Antisense; GCTTAGGATGTCTGCTCTTGAGGCA
>probe:Drosophila_2:1637333_at:310:349; Interrogation_Position=1077; Antisense; GCAGGCGTCCGAATCTCACTGGGAT
>probe:Drosophila_2:1637333_at:247:545; Interrogation_Position=1098; Antisense; GGATGCCCGTCCGAAGTTCCCGAAT
>probe:Drosophila_2:1637333_at:672:373; Interrogation_Position=1110; Antisense; GAAGTTCCCGAATGTCCTTCCGCGT
>probe:Drosophila_2:1637333_at:80:329; Interrogation_Position=1131; Antisense; GCGTCCTTTTGGAAAACACTTTGCA
>probe:Drosophila_2:1637333_at:499:173; Interrogation_Position=1155; Antisense; AAAGCACTTGATGAGCCGGCGCATA
>probe:Drosophila_2:1637333_at:605:323; Interrogation_Position=1173; Antisense; GCGCATAATTAAGCCGGGACCTGAT
>probe:Drosophila_2:1637333_at:264:413; Interrogation_Position=1190; Antisense; GACCTGATGACGGATGGACCGCTGA
>probe:Drosophila_2:1637333_at:513:555; Interrogation_Position=1205; Antisense; GGACCGCTGATTGGAGCAGATCCTC
>probe:Drosophila_2:1637333_at:2:97; Interrogation_Position=1222; Antisense; AGATCCTCCGAATGTCGGGTGGCCG
>probe:Drosophila_2:1637333_at:700:415; Interrogation_Position=1252; Antisense; GAGCCGTTGATAGGCCAGATTGGCC
>probe:Drosophila_2:1637333_at:554:95; Interrogation_Position=1268; Antisense; AGATTGGCCAGATTGGCATCCCGGA
>probe:Drosophila_2:1637333_at:260:271; Interrogation_Position=1284; Antisense; CATCCCGGAGCCCTGGAACTCGTAA

Paste this into a BLAST search page for me
GAGGTGCTTTCACGGCAAGAGCTTAGCTTAGGATGTCTGCTCTTGAGGCAGCAGGCGTCCGAATCTCACTGGGATGGATGCCCGTCCGAAGTTCCCGAATGAAGTTCCCGAATGTCCTTCCGCGTGCGTCCTTTTGGAAAACACTTTGCAAAAGCACTTGATGAGCCGGCGCATAGCGCATAATTAAGCCGGGACCTGATGACCTGATGACGGATGGACCGCTGAGGACCGCTGATTGGAGCAGATCCTCAGATCCTCCGAATGTCGGGTGGCCGGAGCCGTTGATAGGCCAGATTGGCCAGATTGGCCAGATTGGCATCCCGGACATCCCGGAGCCCTGGAACTCGTAA

Full Affymetrix probeset data:

Annotations for 1637333_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720