FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637335_at:

>probe:Drosophila_2:1637335_at:16:525; Interrogation_Position=394; Antisense; GGGAAATACCAAGACCACAGACGTG
>probe:Drosophila_2:1637335_at:575:597; Interrogation_Position=428; Antisense; TGTCCTGCGCACACGGAATATCAGT
>probe:Drosophila_2:1637335_at:589:401; Interrogation_Position=459; Antisense; GACATTGATTCGTATGCACCGGCAA
>probe:Drosophila_2:1637335_at:125:193; Interrogation_Position=496; Antisense; AACTAATTCAAACACTGGCGGCCTC
>probe:Drosophila_2:1637335_at:168:287; Interrogation_Position=510; Antisense; CTGGCGGCCTCGATAAGAACTTATA
>probe:Drosophila_2:1637335_at:222:535; Interrogation_Position=565; Antisense; GGTATGCCAGTGTCCTTTAGTAAGC
>probe:Drosophila_2:1637335_at:290:493; Interrogation_Position=584; Antisense; GTAAGCGCACCTAAATGTACCAATA
>probe:Drosophila_2:1637335_at:410:601; Interrogation_Position=599; Antisense; TGTACCAATAGAACCGTCGGACGAA
>probe:Drosophila_2:1637335_at:442:531; Interrogation_Position=650; Antisense; GGGTAACCACCCATTGTCAAAAGAT
>probe:Drosophila_2:1637335_at:464:677; Interrogation_Position=694; Antisense; TAGTCAGTCAGTAAGCGTTTGCATA
>probe:Drosophila_2:1637335_at:676:21; Interrogation_Position=716; Antisense; ATATCTGCGCATCTCAAAACTCTGT
>probe:Drosophila_2:1637335_at:321:179; Interrogation_Position=732; Antisense; AAACTCTGTATCCTGAATCTGCCTT
>probe:Drosophila_2:1637335_at:599:39; Interrogation_Position=748; Antisense; ATCTGCCTTATGGAGTGGAGACCTT
>probe:Drosophila_2:1637335_at:622:661; Interrogation_Position=855; Antisense; TAACACAACTTACCTCTCAATACAT

Paste this into a BLAST search page for me
GGGAAATACCAAGACCACAGACGTGTGTCCTGCGCACACGGAATATCAGTGACATTGATTCGTATGCACCGGCAAAACTAATTCAAACACTGGCGGCCTCCTGGCGGCCTCGATAAGAACTTATAGGTATGCCAGTGTCCTTTAGTAAGCGTAAGCGCACCTAAATGTACCAATATGTACCAATAGAACCGTCGGACGAAGGGTAACCACCCATTGTCAAAAGATTAGTCAGTCAGTAAGCGTTTGCATAATATCTGCGCATCTCAAAACTCTGTAAACTCTGTATCCTGAATCTGCCTTATCTGCCTTATGGAGTGGAGACCTTTAACACAACTTACCTCTCAATACAT

Full Affymetrix probeset data:

Annotations for 1637335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720