FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637336_at:

>probe:Drosophila_2:1637336_at:2:21; Interrogation_Position=1003; Antisense; ATATATTTAAGCTTTCATGGATCCA
>probe:Drosophila_2:1637336_at:176:269; Interrogation_Position=1018; Antisense; CATGGATCCAAACTCATTACTTGTT
>probe:Drosophila_2:1637336_at:684:417; Interrogation_Position=1104; Antisense; GAGCATGCAGGTGTTCAAAGTTCGA
>probe:Drosophila_2:1637336_at:626:211; Interrogation_Position=638; Antisense; AAGAACATTCGGGATGTGGCCAAGT
>probe:Drosophila_2:1637336_at:426:299; Interrogation_Position=669; Antisense; CGCGCATGCGTGAGCCCATGGAAAA
>probe:Drosophila_2:1637336_at:296:49; Interrogation_Position=748; Antisense; ATGCGCCTTCTATGACCAACGGGAT
>probe:Drosophila_2:1637336_at:356:547; Interrogation_Position=769; Antisense; GGATGGAGACTTCTGTCGCACCGAA
>probe:Drosophila_2:1637336_at:704:453; Interrogation_Position=808; Antisense; GATACCTACTTTTATACTCCACGGA
>probe:Drosophila_2:1637336_at:182:211; Interrogation_Position=833; Antisense; AAGAAGGATCCCATGATAGCAGCGG
>probe:Drosophila_2:1637336_at:456:25; Interrogation_Position=848; Antisense; ATAGCAGCGGAGCACATTCCTTGGC
>probe:Drosophila_2:1637336_at:700:5; Interrogation_Position=863; Antisense; ATTCCTTGGCTGAGGGAGCGTTTGC
>probe:Drosophila_2:1637336_at:69:417; Interrogation_Position=878; Antisense; GAGCGTTTGCCTCATGCGGAATATT
>probe:Drosophila_2:1637336_at:422:243; Interrogation_Position=926; Antisense; AATATCCATTTACGTTATGCGGAGG
>probe:Drosophila_2:1637336_at:644:659; Interrogation_Position=955; Antisense; TAACAAACTGGTGGCCGATTTCTTT

Paste this into a BLAST search page for me
ATATATTTAAGCTTTCATGGATCCACATGGATCCAAACTCATTACTTGTTGAGCATGCAGGTGTTCAAAGTTCGAAAGAACATTCGGGATGTGGCCAAGTCGCGCATGCGTGAGCCCATGGAAAAATGCGCCTTCTATGACCAACGGGATGGATGGAGACTTCTGTCGCACCGAAGATACCTACTTTTATACTCCACGGAAAGAAGGATCCCATGATAGCAGCGGATAGCAGCGGAGCACATTCCTTGGCATTCCTTGGCTGAGGGAGCGTTTGCGAGCGTTTGCCTCATGCGGAATATTAATATCCATTTACGTTATGCGGAGGTAACAAACTGGTGGCCGATTTCTTT

Full Affymetrix probeset data:

Annotations for 1637336_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720