FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637338_at:

>probe:Drosophila_2:1637338_at:627:411; Interrogation_Position=139; Antisense; GACCTGGACTGGACGGGCGCCAATT
>probe:Drosophila_2:1637338_at:259:249; Interrogation_Position=160; Antisense; AATTGGCAGCTGGTGGTCCGCTTTC
>probe:Drosophila_2:1637338_at:126:491; Interrogation_Position=17; Antisense; GTAACCTGGGATCAATACTGCTCCT
>probe:Drosophila_2:1637338_at:536:355; Interrogation_Position=217; Antisense; GCACTGGCCAGATTCGATGAGCAAT
>probe:Drosophila_2:1637338_at:89:445; Interrogation_Position=232; Antisense; GATGAGCAATTGGTGCCCGGCACAG
>probe:Drosophila_2:1637338_at:184:303; Interrogation_Position=283; Antisense; CCGCTTATGGCCAACTGCGATATTG
>probe:Drosophila_2:1637338_at:57:79; Interrogation_Position=317; Antisense; AGGATCTGACCATGACCTTGCGCTA
>probe:Drosophila_2:1637338_at:217:721; Interrogation_Position=334; Antisense; TTGCGCTATGCCTTCGGCGAAATTC
>probe:Drosophila_2:1637338_at:144:575; Interrogation_Position=349; Antisense; GGCGAAATTCTGCTGGACACAAGTC
>probe:Drosophila_2:1637338_at:10:185; Interrogation_Position=375; Antisense; AAAATGCCGTCCTGGCTTGGAGCTA
>probe:Drosophila_2:1637338_at:295:417; Interrogation_Position=394; Antisense; GAGCTATTCGGAGTTCGCTGCAGGC
>probe:Drosophila_2:1637338_at:659:275; Interrogation_Position=40; Antisense; CTTCTGCTCATCATCTGTATCGAAC
>probe:Drosophila_2:1637338_at:408:601; Interrogation_Position=55; Antisense; TGTATCGAACGCTCGCGACAGCAAC
>probe:Drosophila_2:1637338_at:124:347; Interrogation_Position=87; Antisense; GCATCCCGAATCCTGGACGGATAAT

Paste this into a BLAST search page for me
GACCTGGACTGGACGGGCGCCAATTAATTGGCAGCTGGTGGTCCGCTTTCGTAACCTGGGATCAATACTGCTCCTGCACTGGCCAGATTCGATGAGCAATGATGAGCAATTGGTGCCCGGCACAGCCGCTTATGGCCAACTGCGATATTGAGGATCTGACCATGACCTTGCGCTATTGCGCTATGCCTTCGGCGAAATTCGGCGAAATTCTGCTGGACACAAGTCAAAATGCCGTCCTGGCTTGGAGCTAGAGCTATTCGGAGTTCGCTGCAGGCCTTCTGCTCATCATCTGTATCGAACTGTATCGAACGCTCGCGACAGCAACGCATCCCGAATCCTGGACGGATAAT

Full Affymetrix probeset data:

Annotations for 1637338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720