FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637339_at:

>probe:Drosophila_2:1637339_at:33:59; Interrogation_Position=13; Antisense; ATGAGGATTTCCCTGAGGCTGCTTG
>probe:Drosophila_2:1637339_at:153:423; Interrogation_Position=145; Antisense; GAGAAGCGACCGTTTTGCAATGCAT
>probe:Drosophila_2:1637339_at:372:615; Interrogation_Position=160; Antisense; TGCAATGCATTTACAGGCTGTGGAC
>probe:Drosophila_2:1637339_at:560:399; Interrogation_Position=182; Antisense; GACGAAAGCGTACGTATCCCTCGTA
>probe:Drosophila_2:1637339_at:40:485; Interrogation_Position=204; Antisense; GTATCCGCCATTCTCGCTATTCAAA
>probe:Drosophila_2:1637339_at:589:339; Interrogation_Position=219; Antisense; GCTATTCAAACGCAACGAAGTCGAA
>probe:Drosophila_2:1637339_at:664:427; Interrogation_Position=262; Antisense; GAGTATTTATCCGAAGGTCTAAGTG
>probe:Drosophila_2:1637339_at:252:71; Interrogation_Position=28; Antisense; AGGCTGCTTGCACTCCTGGCTTGTG
>probe:Drosophila_2:1637339_at:691:455; Interrogation_Position=295; Antisense; GATATCAATGCCGAGCCAGCTGTGG
>probe:Drosophila_2:1637339_at:466:255; Interrogation_Position=328; Antisense; CAAAAGCAAATCATGTCGCAGGCCA
>probe:Drosophila_2:1637339_at:1:127; Interrogation_Position=375; Antisense; AGCCAGCAAGGAAATCTTTCGGCAA
>probe:Drosophila_2:1637339_at:64:287; Interrogation_Position=43; Antisense; CTGGCTTGTGCCATTTGCTCTCAGG
>probe:Drosophila_2:1637339_at:274:723; Interrogation_Position=57; Antisense; TTGCTCTCAGGCTTCGCTGGAAAGG
>probe:Drosophila_2:1637339_at:716:185; Interrogation_Position=85; Antisense; AACAACGAGGGCACCAATATGGCAA

Paste this into a BLAST search page for me
ATGAGGATTTCCCTGAGGCTGCTTGGAGAAGCGACCGTTTTGCAATGCATTGCAATGCATTTACAGGCTGTGGACGACGAAAGCGTACGTATCCCTCGTAGTATCCGCCATTCTCGCTATTCAAAGCTATTCAAACGCAACGAAGTCGAAGAGTATTTATCCGAAGGTCTAAGTGAGGCTGCTTGCACTCCTGGCTTGTGGATATCAATGCCGAGCCAGCTGTGGCAAAAGCAAATCATGTCGCAGGCCAAGCCAGCAAGGAAATCTTTCGGCAACTGGCTTGTGCCATTTGCTCTCAGGTTGCTCTCAGGCTTCGCTGGAAAGGAACAACGAGGGCACCAATATGGCAA

Full Affymetrix probeset data:

Annotations for 1637339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720