FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637341_at:

>probe:Drosophila_2:1637341_at:149:67; Interrogation_Position=1008; Antisense; ATGGACGGGTTCGATCAGACCACGA
>probe:Drosophila_2:1637341_at:349:35; Interrogation_Position=1044; Antisense; ATCATGGCTACCAACAGGGCGGACA
>probe:Drosophila_2:1637341_at:527:559; Interrogation_Position=1064; Antisense; GGACACACTCGATCCGGCATTGCTG
>probe:Drosophila_2:1637341_at:460:623; Interrogation_Position=1087; Antisense; TGCGACCTGGTCGATTGGATCGTAA
>probe:Drosophila_2:1637341_at:93:43; Interrogation_Position=1105; Antisense; ATCGTAAGATTGAGTTCCCGCTGCC
>probe:Drosophila_2:1637341_at:527:45; Interrogation_Position=1132; Antisense; ATCGCCGGCAGAAGCGACTCGTCTT
>probe:Drosophila_2:1637341_at:151:33; Interrogation_Position=1164; Antisense; ATCACCTCGAAGATGAACCTAAGCG
>probe:Drosophila_2:1637341_at:408:161; Interrogation_Position=1225; Antisense; ACAAGATCTCCGGTGCCGATATCAA
>probe:Drosophila_2:1637341_at:75:507; Interrogation_Position=1237; Antisense; GTGCCGATATCAACGCCATTTGCCA
>probe:Drosophila_2:1637341_at:83:135; Interrogation_Position=1276; Antisense; ACGCGGTGCGTGAGAATCGCTACAT
>probe:Drosophila_2:1637341_at:334:43; Interrogation_Position=1291; Antisense; ATCGCTACATCGTTTTGGCCAAGGA
>probe:Drosophila_2:1637341_at:154:3; Interrogation_Position=1385; Antisense; ATTAATTCATACACACTACTCCCGC
>probe:Drosophila_2:1637341_at:379:147; Interrogation_Position=1430; Antisense; ACTAAACTCTTCTTTGTACGCATAA
>probe:Drosophila_2:1637341_at:645:205; Interrogation_Position=939; Antisense; AAGCGTTTCGATGCGCAGACTGGCG

Paste this into a BLAST search page for me
ATGGACGGGTTCGATCAGACCACGAATCATGGCTACCAACAGGGCGGACAGGACACACTCGATCCGGCATTGCTGTGCGACCTGGTCGATTGGATCGTAAATCGTAAGATTGAGTTCCCGCTGCCATCGCCGGCAGAAGCGACTCGTCTTATCACCTCGAAGATGAACCTAAGCGACAAGATCTCCGGTGCCGATATCAAGTGCCGATATCAACGCCATTTGCCAACGCGGTGCGTGAGAATCGCTACATATCGCTACATCGTTTTGGCCAAGGAATTAATTCATACACACTACTCCCGCACTAAACTCTTCTTTGTACGCATAAAAGCGTTTCGATGCGCAGACTGGCG

Full Affymetrix probeset data:

Annotations for 1637341_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720