FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637345_at:

>probe:Drosophila_2:1637345_at:463:707; Interrogation_Position=316; Antisense; TTACACGCTTCAATGGGCTGTCAAA
>probe:Drosophila_2:1637345_at:633:203; Interrogation_Position=350; Antisense; AAGCCTGAATTTGAATCCGCATTAG
>probe:Drosophila_2:1637345_at:433:707; Interrogation_Position=371; Antisense; TTAGCTGAGCGCTTTTGGCGAACCT
>probe:Drosophila_2:1637345_at:255:357; Interrogation_Position=449; Antisense; GCAACTTTAAGTCATCCATCAGGCC
>probe:Drosophila_2:1637345_at:615:181; Interrogation_Position=488; Antisense; AAAAGTGGCCCCTCGAGTGTCATTT
>probe:Drosophila_2:1637345_at:201:433; Interrogation_Position=502; Antisense; GAGTGTCATTTCATACGGTATCGGT
>probe:Drosophila_2:1637345_at:31:43; Interrogation_Position=521; Antisense; ATCGGTTCGTCTGCTATCGTGCAAC
>probe:Drosophila_2:1637345_at:542:271; Interrogation_Position=667; Antisense; CATCGGTATCATTATCTTCGTCCAT
>probe:Drosophila_2:1637345_at:1:319; Interrogation_Position=692; Antisense; GCCGTCATCGAATCCAATGGCTCAA
>probe:Drosophila_2:1637345_at:364:651; Interrogation_Position=713; Antisense; TCAAATGACATTTCCGCACCTGACG
>probe:Drosophila_2:1637345_at:567:217; Interrogation_Position=773; Antisense; AAGTCATTCATCACCAAGCAGCTAT
>probe:Drosophila_2:1637345_at:675:285; Interrogation_Position=806; Antisense; CTGTGCCTTGTCTATATCTCTTTGA
>probe:Drosophila_2:1637345_at:450:37; Interrogation_Position=821; Antisense; ATCTCTTTGATACCCTTTGCAAGTG
>probe:Drosophila_2:1637345_at:157:211; Interrogation_Position=886; Antisense; AAGAAGCTAGTTTTTGATGCCAGTA

Paste this into a BLAST search page for me
TTACACGCTTCAATGGGCTGTCAAAAAGCCTGAATTTGAATCCGCATTAGTTAGCTGAGCGCTTTTGGCGAACCTGCAACTTTAAGTCATCCATCAGGCCAAAAGTGGCCCCTCGAGTGTCATTTGAGTGTCATTTCATACGGTATCGGTATCGGTTCGTCTGCTATCGTGCAACCATCGGTATCATTATCTTCGTCCATGCCGTCATCGAATCCAATGGCTCAATCAAATGACATTTCCGCACCTGACGAAGTCATTCATCACCAAGCAGCTATCTGTGCCTTGTCTATATCTCTTTGAATCTCTTTGATACCCTTTGCAAGTGAAGAAGCTAGTTTTTGATGCCAGTA

Full Affymetrix probeset data:

Annotations for 1637345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720