FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637346_at:

>probe:Drosophila_2:1637346_at:554:681; Interrogation_Position=132; Antisense; TATGGACATGAAGGGTGCCACCGCC
>probe:Drosophila_2:1637346_at:339:147; Interrogation_Position=161; Antisense; ACTTGTTCCAGATGACGCCGTCGAT
>probe:Drosophila_2:1637346_at:17:319; Interrogation_Position=177; Antisense; GCCGTCGATGGCCAAGAAATTCACT
>probe:Drosophila_2:1637346_at:549:161; Interrogation_Position=193; Antisense; AAATTCACTGTCTTCTCGGAGGAGG
>probe:Drosophila_2:1637346_at:566:75; Interrogation_Position=212; Antisense; AGGAGGCACTTCCACTGCGTCTGAA
>probe:Drosophila_2:1637346_at:59:73; Interrogation_Position=236; Antisense; AGGCACAGCATTTCATCAACACCAT
>probe:Drosophila_2:1637346_at:31:515; Interrogation_Position=265; Antisense; GGATTCGAGCAGCTGTTCAACATGT
>probe:Drosophila_2:1637346_at:401:387; Interrogation_Position=309; Antisense; GAAAATGCAGTCTCGCCTATTTGTG
>probe:Drosophila_2:1637346_at:427:279; Interrogation_Position=352; Antisense; CTCTTGACGGAGCAGATTCCACTGA
>probe:Drosophila_2:1637346_at:507:7; Interrogation_Position=367; Antisense; ATTCCACTGAAATATCTGCCCGAGG
>probe:Drosophila_2:1637346_at:19:429; Interrogation_Position=454; Antisense; GAGTACGCCGATTTCTTCCAGGAAA
>probe:Drosophila_2:1637346_at:566:183; Interrogation_Position=476; Antisense; AAAATGTGAACTTCGGCACCGACGA
>probe:Drosophila_2:1637346_at:533:589; Interrogation_Position=506; Antisense; TGCGTCCCGGAAAACCAATCGATTT
>probe:Drosophila_2:1637346_at:213:549; Interrogation_Position=93; Antisense; GGAGGACGACTACGCCAATGTCAAT

Paste this into a BLAST search page for me
TATGGACATGAAGGGTGCCACCGCCACTTGTTCCAGATGACGCCGTCGATGCCGTCGATGGCCAAGAAATTCACTAAATTCACTGTCTTCTCGGAGGAGGAGGAGGCACTTCCACTGCGTCTGAAAGGCACAGCATTTCATCAACACCATGGATTCGAGCAGCTGTTCAACATGTGAAAATGCAGTCTCGCCTATTTGTGCTCTTGACGGAGCAGATTCCACTGAATTCCACTGAAATATCTGCCCGAGGGAGTACGCCGATTTCTTCCAGGAAAAAAATGTGAACTTCGGCACCGACGATGCGTCCCGGAAAACCAATCGATTTGGAGGACGACTACGCCAATGTCAAT

Full Affymetrix probeset data:

Annotations for 1637346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720