Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637347_at:

>probe:Drosophila_2:1637347_at:88:273; Interrogation_Position=129; Antisense; CATAGAGCAGAGTCCACCCATCGAA
>probe:Drosophila_2:1637347_at:96:587; Interrogation_Position=155; Antisense; TGGACACCAGCCAGAGCTACATTGC
>probe:Drosophila_2:1637347_at:388:721; Interrogation_Position=176; Antisense; TTGCCGTCTACACTCATCTCAAAGT
>probe:Drosophila_2:1637347_at:577:219; Interrogation_Position=197; Antisense; AAGTGCACGCCACCATGATGCCGGA
>probe:Drosophila_2:1637347_at:78:447; Interrogation_Position=213; Antisense; GATGCCGGAGAGATTGCCCACGCCG
>probe:Drosophila_2:1637347_at:137:289; Interrogation_Position=260; Antisense; CGGAGAACTTGGAGGCAGCGCCCAA
>probe:Drosophila_2:1637347_at:712:121; Interrogation_Position=276; Antisense; AGCGCCCAAGGCACGAAGTTCAAAG
>probe:Drosophila_2:1637347_at:336:187; Interrogation_Position=28; Antisense; AACAGCGAGCAGTTGGACACCGACC
>probe:Drosophila_2:1637347_at:254:373; Interrogation_Position=290; Antisense; GAAGTTCAAAGACCCGCTTGGATCC
>probe:Drosophila_2:1637347_at:556:297; Interrogation_Position=304; Antisense; CGCTTGGATCCCTGCTCAAATATAA
>probe:Drosophila_2:1637347_at:277:399; Interrogation_Position=43; Antisense; GACACCGACCGCGATGGACTGCAAA
>probe:Drosophila_2:1637347_at:346:557; Interrogation_Position=58; Antisense; GGACTGCAAAAAATTCTGGCCCGAT
>probe:Drosophila_2:1637347_at:105:247; Interrogation_Position=69; Antisense; AATTCTGGCCCGATCTCTCAAGGAA
>probe:Drosophila_2:1637347_at:605:73; Interrogation_Position=89; Antisense; AGGAACCCATTCTTGGCAAGCACTT

Paste this into a BLAST search page for me
CATAGAGCAGAGTCCACCCATCGAATGGACACCAGCCAGAGCTACATTGCTTGCCGTCTACACTCATCTCAAAGTAAGTGCACGCCACCATGATGCCGGAGATGCCGGAGAGATTGCCCACGCCGCGGAGAACTTGGAGGCAGCGCCCAAAGCGCCCAAGGCACGAAGTTCAAAGAACAGCGAGCAGTTGGACACCGACCGAAGTTCAAAGACCCGCTTGGATCCCGCTTGGATCCCTGCTCAAATATAAGACACCGACCGCGATGGACTGCAAAGGACTGCAAAAAATTCTGGCCCGATAATTCTGGCCCGATCTCTCAAGGAAAGGAACCCATTCTTGGCAAGCACTT

Full Affymetrix probeset data:

Annotations for 1637347_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime