FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637349_at:

>probe:Drosophila_2:1637349_at:179:45; Interrogation_Position=2470; Antisense; ATCGCCCAGAGCTTGACGCACTTGG
>probe:Drosophila_2:1637349_at:578:729; Interrogation_Position=2491; Antisense; TTGGGCAAGGGCACGCTCTCGCTGA
>probe:Drosophila_2:1637349_at:697:429; Interrogation_Position=2514; Antisense; GAGTCCCTACCACAGCGATAGGCAG
>probe:Drosophila_2:1637349_at:457:25; Interrogation_Position=2531; Antisense; ATAGGCAGCTGATGAACCCCATGGC
>probe:Drosophila_2:1637349_at:178:69; Interrogation_Position=2551; Antisense; ATGGCCGTCGCTGGACTGATGGCTA
>probe:Drosophila_2:1637349_at:188:405; Interrogation_Position=2564; Antisense; GACTGATGGCTACGCTGGTTTCCCT
>probe:Drosophila_2:1637349_at:236:591; Interrogation_Position=2579; Antisense; TGGTTTCCCTGCTGGACGTGAAGAA
>probe:Drosophila_2:1637349_at:612:509; Interrogation_Position=2596; Antisense; GTGAAGAACCTGATACTGAACCGAT
>probe:Drosophila_2:1637349_at:34:615; Interrogation_Position=2612; Antisense; TGAACCGATCGCACTATCTGCTCTA
>probe:Drosophila_2:1637349_at:534:347; Interrogation_Position=2663; Antisense; GCATGCTGATCACCTTCGATGAGGA
>probe:Drosophila_2:1637349_at:572:7; Interrogation_Position=2722; Antisense; ATTGCCATCGATGTGGTCGGCCAGG
>probe:Drosophila_2:1637349_at:472:631; Interrogation_Position=2853; Antisense; TCCGGTCATGGAGGGCTTCGTTATA
>probe:Drosophila_2:1637349_at:215:649; Interrogation_Position=2956; Antisense; TCAGCCACTAACTCCCAATAATTAT
>probe:Drosophila_2:1637349_at:445:301; Interrogation_Position=2988; Antisense; CCCCACTGGCAGTTGATTCAAATGA

Paste this into a BLAST search page for me
ATCGCCCAGAGCTTGACGCACTTGGTTGGGCAAGGGCACGCTCTCGCTGAGAGTCCCTACCACAGCGATAGGCAGATAGGCAGCTGATGAACCCCATGGCATGGCCGTCGCTGGACTGATGGCTAGACTGATGGCTACGCTGGTTTCCCTTGGTTTCCCTGCTGGACGTGAAGAAGTGAAGAACCTGATACTGAACCGATTGAACCGATCGCACTATCTGCTCTAGCATGCTGATCACCTTCGATGAGGAATTGCCATCGATGTGGTCGGCCAGGTCCGGTCATGGAGGGCTTCGTTATATCAGCCACTAACTCCCAATAATTATCCCCACTGGCAGTTGATTCAAATGA

Full Affymetrix probeset data:

Annotations for 1637349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720