FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637350_at:

>probe:Drosophila_2:1637350_at:614:333; Interrogation_Position=140; Antisense; GCTGGTCACGATTCCGATGGCGACA
>probe:Drosophila_2:1637350_at:239:277; Interrogation_Position=20; Antisense; CTAGCCGCCGCCAAAAATAACTATC
>probe:Drosophila_2:1637350_at:314:287; Interrogation_Position=207; Antisense; CGGCCAAGATTATCCCCAACAAGGG
>probe:Drosophila_2:1637350_at:295:277; Interrogation_Position=238; Antisense; CTACGTGGCGTATGCCAACCAGGAG
>probe:Drosophila_2:1637350_at:514:107; Interrogation_Position=273; Antisense; AGAACTACGAGGTACTCAGCGGCTT
>probe:Drosophila_2:1637350_at:21:651; Interrogation_Position=288; Antisense; TCAGCGGCTTCAACTACGAGTGGCT
>probe:Drosophila_2:1637350_at:578:319; Interrogation_Position=342; Antisense; GCGCCGTCAAGGTCGGCCAGAATGT
>probe:Drosophila_2:1637350_at:685:407; Interrogation_Position=368; Antisense; GACGGAGAGACCTTGTACGCCGGAA
>probe:Drosophila_2:1637350_at:428:47; Interrogation_Position=402; Antisense; ATGCCGGCAGTTTGACCGTGGGCAA
>probe:Drosophila_2:1637350_at:231:95; Interrogation_Position=480; Antisense; AGATATTCGCCTACGAGGTTCTGTC
>probe:Drosophila_2:1637350_at:230:599; Interrogation_Position=501; Antisense; TGTCCCGTCGCTTGGAGGCGAGATA
>probe:Drosophila_2:1637350_at:535:651; Interrogation_Position=62; Antisense; TCAAGCAGCTCAATCGAAATGGACG
>probe:Drosophila_2:1637350_at:120:169; Interrogation_Position=78; Antisense; AAATGGACGGTCACAGCTGGCTTCA
>probe:Drosophila_2:1637350_at:445:583; Interrogation_Position=95; Antisense; TGGCTTCACTTCAGCAACGGAGCAA

Paste this into a BLAST search page for me
GCTGGTCACGATTCCGATGGCGACACTAGCCGCCGCCAAAAATAACTATCCGGCCAAGATTATCCCCAACAAGGGCTACGTGGCGTATGCCAACCAGGAGAGAACTACGAGGTACTCAGCGGCTTTCAGCGGCTTCAACTACGAGTGGCTGCGCCGTCAAGGTCGGCCAGAATGTGACGGAGAGACCTTGTACGCCGGAAATGCCGGCAGTTTGACCGTGGGCAAAGATATTCGCCTACGAGGTTCTGTCTGTCCCGTCGCTTGGAGGCGAGATATCAAGCAGCTCAATCGAAATGGACGAAATGGACGGTCACAGCTGGCTTCATGGCTTCACTTCAGCAACGGAGCAA

Full Affymetrix probeset data:

Annotations for 1637350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720