Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637351_at:

>probe:Drosophila_2:1637351_at:469:493; Interrogation_Position=1416; Antisense; GTAATATCCATATTTCTGCGAGCAG
>probe:Drosophila_2:1637351_at:225:167; Interrogation_Position=1457; Antisense; AAATGTGCGGGATCTGAGCTCGGAC
>probe:Drosophila_2:1637351_at:99:555; Interrogation_Position=1478; Antisense; GGACTGTTCCCTTGGTTGTTACCTG
>probe:Drosophila_2:1637351_at:710:703; Interrogation_Position=1496; Antisense; TTACCTGGTCACTGATGCGGCCATA
>probe:Drosophila_2:1637351_at:478:211; Interrogation_Position=1599; Antisense; AAGAACTGCGACTTGGGCATCGTCT
>probe:Drosophila_2:1637351_at:193:525; Interrogation_Position=1613; Antisense; GGGCATCGTCTTTGAATACCATCAT
>probe:Drosophila_2:1637351_at:643:673; Interrogation_Position=1629; Antisense; TACCATCATTCAAAGCGGCAGACCG
>probe:Drosophila_2:1637351_at:651:349; Interrogation_Position=1646; Antisense; GCAGACCGGTGGTTGCGATTCTCCA
>probe:Drosophila_2:1637351_at:189:243; Interrogation_Position=1699; Antisense; AATATATCGGCAGGGTTCTCGGACT
>probe:Drosophila_2:1637351_at:92:641; Interrogation_Position=1717; Antisense; TCGGACTTCCTTTGGAGCAGCTGAA
>probe:Drosophila_2:1637351_at:456:261; Interrogation_Position=1734; Antisense; CAGCTGAAATACCTGTACTCCGTTC
>probe:Drosophila_2:1637351_at:82:165; Interrogation_Position=1774; Antisense; AAATCACTGAGCACGACACTAGGAG
>probe:Drosophila_2:1637351_at:463:369; Interrogation_Position=1807; Antisense; GAAGTCAGTTACACTCAGTTTCCAC
>probe:Drosophila_2:1637351_at:255:507; Interrogation_Position=1885; Antisense; GTGCCCGTACAAAACTACCATCAGT

Paste this into a BLAST search page for me
GTAATATCCATATTTCTGCGAGCAGAAATGTGCGGGATCTGAGCTCGGACGGACTGTTCCCTTGGTTGTTACCTGTTACCTGGTCACTGATGCGGCCATAAAGAACTGCGACTTGGGCATCGTCTGGGCATCGTCTTTGAATACCATCATTACCATCATTCAAAGCGGCAGACCGGCAGACCGGTGGTTGCGATTCTCCAAATATATCGGCAGGGTTCTCGGACTTCGGACTTCCTTTGGAGCAGCTGAACAGCTGAAATACCTGTACTCCGTTCAAATCACTGAGCACGACACTAGGAGGAAGTCAGTTACACTCAGTTTCCACGTGCCCGTACAAAACTACCATCAGT

Full Affymetrix probeset data:

Annotations for 1637351_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime