FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637353_at:

>probe:Drosophila_2:1637353_at:445:227; Interrogation_Position=1028; Antisense; AAGGCGGCGCAGACCAAGCTGTAGA
>probe:Drosophila_2:1637353_at:205:407; Interrogation_Position=1051; Antisense; GACGATCTGAGTTCGGATTTTGTAC
>probe:Drosophila_2:1637353_at:341:575; Interrogation_Position=1109; Antisense; GGCGGGTTCCCAGTAGTGTATCAAC
>probe:Drosophila_2:1637353_at:439:515; Interrogation_Position=1124; Antisense; GTGTATCAACGTTCGATTCAGCGTA
>probe:Drosophila_2:1637353_at:71:681; Interrogation_Position=1178; Antisense; TATCTAATTTAATCTTCCCGTCGCG
>probe:Drosophila_2:1637353_at:322:211; Interrogation_Position=671; Antisense; AAGAAGATCCTCTCGCTGATGGACC
>probe:Drosophila_2:1637353_at:31:415; Interrogation_Position=692; Antisense; GACCACGTGGAGGAGCAGTTCAACA
>probe:Drosophila_2:1637353_at:279:351; Interrogation_Position=706; Antisense; GCAGTTCAACATCTTCGACGTGTAT
>probe:Drosophila_2:1637353_at:323:407; Interrogation_Position=722; Antisense; GACGTGTATCCCGACGAGGAGCTCA
>probe:Drosophila_2:1637353_at:512:553; Interrogation_Position=739; Antisense; GGAGCTCATCCTGGACGGCAAGATC
>probe:Drosophila_2:1637353_at:220:361; Interrogation_Position=756; Antisense; GCAAGATCCTGTCGGTGGACACCAA
>probe:Drosophila_2:1637353_at:614:345; Interrogation_Position=846; Antisense; GCATCAATGTGTACCACGTGCTCTG
>probe:Drosophila_2:1637353_at:406:207; Interrogation_Position=902; Antisense; AAGCTGGGCTTCCACGAGGTGTTCC
>probe:Drosophila_2:1637353_at:313:81; Interrogation_Position=918; Antisense; AGGTGTTCCGCATGCAGTTCGCCGA

Paste this into a BLAST search page for me
AAGGCGGCGCAGACCAAGCTGTAGAGACGATCTGAGTTCGGATTTTGTACGGCGGGTTCCCAGTAGTGTATCAACGTGTATCAACGTTCGATTCAGCGTATATCTAATTTAATCTTCCCGTCGCGAAGAAGATCCTCTCGCTGATGGACCGACCACGTGGAGGAGCAGTTCAACAGCAGTTCAACATCTTCGACGTGTATGACGTGTATCCCGACGAGGAGCTCAGGAGCTCATCCTGGACGGCAAGATCGCAAGATCCTGTCGGTGGACACCAAGCATCAATGTGTACCACGTGCTCTGAAGCTGGGCTTCCACGAGGTGTTCCAGGTGTTCCGCATGCAGTTCGCCGA

Full Affymetrix probeset data:

Annotations for 1637353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720