FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637354_at:

>probe:Drosophila_2:1637354_at:697:223; Interrogation_Position=1477; Antisense; AAGGAAGTGCATCCCCATTACAATC
>probe:Drosophila_2:1637354_at:515:235; Interrogation_Position=1498; Antisense; AATCCGGCAGACTTTGTAAATGACG
>probe:Drosophila_2:1637354_at:723:663; Interrogation_Position=1514; Antisense; TAAATGACGTGGCTCTGATCCGCTT
>probe:Drosophila_2:1637354_at:682:571; Interrogation_Position=1524; Antisense; GGCTCTGATCCGCTTGGACAGGAAT
>probe:Drosophila_2:1637354_at:580:451; Interrogation_Position=1698; Antisense; GATCTCGAATGATCGCTGTCAGCGA
>probe:Drosophila_2:1637354_at:32:427; Interrogation_Position=1745; Antisense; GAGAGGCCATCCACGATGTGAGTAA
>probe:Drosophila_2:1637354_at:454:3; Interrogation_Position=1772; Antisense; ATTGGCATAGACTTAAGACCGGCAT
>probe:Drosophila_2:1637354_at:604:3; Interrogation_Position=1822; Antisense; ATTGAGCAACTTCTTTTCGTCCAGG
>probe:Drosophila_2:1637354_at:99:79; Interrogation_Position=1844; Antisense; AGGTCTTCTTGTGCGCAGGCTACAA
>probe:Drosophila_2:1637354_at:252:519; Interrogation_Position=1901; Antisense; GTGGTGGTCCACTAACATTGACCAT
>probe:Drosophila_2:1637354_at:424:103; Interrogation_Position=1937; Antisense; AGACCCTGATCGGATTGGTGTCCTG
>probe:Drosophila_2:1637354_at:335:573; Interrogation_Position=1993; Antisense; GGCGTCTATACGAACATCCAGCGTT
>probe:Drosophila_2:1637354_at:371:479; Interrogation_Position=2015; Antisense; GTTTCGTGCCCTGGATCAACAAGGT
>probe:Drosophila_2:1637354_at:455:539; Interrogation_Position=2037; Antisense; GGTTATGGCCAATGACAACGCGTAG

Paste this into a BLAST search page for me
AAGGAAGTGCATCCCCATTACAATCAATCCGGCAGACTTTGTAAATGACGTAAATGACGTGGCTCTGATCCGCTTGGCTCTGATCCGCTTGGACAGGAATGATCTCGAATGATCGCTGTCAGCGAGAGAGGCCATCCACGATGTGAGTAAATTGGCATAGACTTAAGACCGGCATATTGAGCAACTTCTTTTCGTCCAGGAGGTCTTCTTGTGCGCAGGCTACAAGTGGTGGTCCACTAACATTGACCATAGACCCTGATCGGATTGGTGTCCTGGGCGTCTATACGAACATCCAGCGTTGTTTCGTGCCCTGGATCAACAAGGTGGTTATGGCCAATGACAACGCGTAG

Full Affymetrix probeset data:

Annotations for 1637354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720