FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637355_at:

>probe:Drosophila_2:1637355_at:393:567; Interrogation_Position=185; Antisense; GGCACTTCGTGCATCAATACTATAT
>probe:Drosophila_2:1637355_at:189:23; Interrogation_Position=206; Antisense; ATATACCAGTGCTTTGCTGCACGGG
>probe:Drosophila_2:1637355_at:417:3; Interrogation_Position=235; Antisense; ATTGGCAATATCCTCTCCGTGTTTG
>probe:Drosophila_2:1637355_at:510:631; Interrogation_Position=250; Antisense; TCCGTGTTTGTCTTCTTTAGGACCA
>probe:Drosophila_2:1637355_at:476:557; Interrogation_Position=343; Antisense; GGACTCTTCGCACAGTGGCTGAACT
>probe:Drosophila_2:1637355_at:697:521; Interrogation_Position=357; Antisense; GTGGCTGAACTTCCTCAATGTGGAT
>probe:Drosophila_2:1637355_at:238:193; Interrogation_Position=394; Antisense; AACTACTTTTGCCAGTTCTTCACGT
>probe:Drosophila_2:1637355_at:487:451; Interrogation_Position=540; Antisense; GATCGTCCTGTTTTGTTTGACACTC
>probe:Drosophila_2:1637355_at:77:157; Interrogation_Position=559; Antisense; ACACTCGTGGGATGTCTGCACTGTC
>probe:Drosophila_2:1637355_at:219:355; Interrogation_Position=576; Antisense; GCACTGTCTGCCCTATATAGTCATT
>probe:Drosophila_2:1637355_at:267:687; Interrogation_Position=591; Antisense; TATAGTCATTGCCAAGCCGGTGTTT
>probe:Drosophila_2:1637355_at:116:203; Interrogation_Position=604; Antisense; AAGCCGGTGTTTATGCCCAAATTGA
>probe:Drosophila_2:1637355_at:492:413; Interrogation_Position=633; Antisense; GACCATTTGCGATCTCAACTCGGAA
>probe:Drosophila_2:1637355_at:666:395; Interrogation_Position=713; Antisense; GAAATTTATCTACCATTTCCCGCAC

Paste this into a BLAST search page for me
GGCACTTCGTGCATCAATACTATATATATACCAGTGCTTTGCTGCACGGGATTGGCAATATCCTCTCCGTGTTTGTCCGTGTTTGTCTTCTTTAGGACCAGGACTCTTCGCACAGTGGCTGAACTGTGGCTGAACTTCCTCAATGTGGATAACTACTTTTGCCAGTTCTTCACGTGATCGTCCTGTTTTGTTTGACACTCACACTCGTGGGATGTCTGCACTGTCGCACTGTCTGCCCTATATAGTCATTTATAGTCATTGCCAAGCCGGTGTTTAAGCCGGTGTTTATGCCCAAATTGAGACCATTTGCGATCTCAACTCGGAAGAAATTTATCTACCATTTCCCGCAC

Full Affymetrix probeset data:

Annotations for 1637355_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720