FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637358_at:

>probe:Drosophila_2:1637358_at:705:523; Interrogation_Position=357; Antisense; GGGCGAGCATGATATTACCACCAAT
>probe:Drosophila_2:1637358_at:668:127; Interrogation_Position=376; Antisense; ACCAATCCGGATTGCGACTTTACAG
>probe:Drosophila_2:1637358_at:526:403; Interrogation_Position=391; Antisense; GACTTTACAGGAAACTGCGCTGCCC
>probe:Drosophila_2:1637358_at:505:569; Interrogation_Position=430; Antisense; GGCATCGAGTATTTCAATGTCCACG
>probe:Drosophila_2:1637358_at:93:459; Interrogation_Position=487; Antisense; GATATCGCCTTGGTGCGTCTTCAAA
>probe:Drosophila_2:1637358_at:221:177; Interrogation_Position=509; Antisense; AAACGCCAGTTCGATATACCCACGA
>probe:Drosophila_2:1637358_at:98:395; Interrogation_Position=532; Antisense; GAAATTCTACCGATTTGTGTGCCGA
>probe:Drosophila_2:1637358_at:617:19; Interrogation_Position=544; Antisense; ATTTGTGTGCCGAAAGATCCCATCC
>probe:Drosophila_2:1637358_at:546:29; Interrogation_Position=575; Antisense; ATAATCACCCATTGCAAATCGCCGG
>probe:Drosophila_2:1637358_at:139:107; Interrogation_Position=678; Antisense; AGACAAGATATCGTTCTTCCGCAAC
>probe:Drosophila_2:1637358_at:721:163; Interrogation_Position=710; Antisense; AAATCTGTGCTTCTGGCATTCGAGG
>probe:Drosophila_2:1637358_at:211:105; Interrogation_Position=738; Antisense; AGACTCCTGTGAGGGTGATTCCGGA
>probe:Drosophila_2:1637358_at:40:465; Interrogation_Position=754; Antisense; GATTCCGGAGGTCCCTTGATGTTAA
>probe:Drosophila_2:1637358_at:438:23; Interrogation_Position=807; Antisense; ATATCTGGCCGGTATCGTTTCATAT

Paste this into a BLAST search page for me
GGGCGAGCATGATATTACCACCAATACCAATCCGGATTGCGACTTTACAGGACTTTACAGGAAACTGCGCTGCCCGGCATCGAGTATTTCAATGTCCACGGATATCGCCTTGGTGCGTCTTCAAAAAACGCCAGTTCGATATACCCACGAGAAATTCTACCGATTTGTGTGCCGAATTTGTGTGCCGAAAGATCCCATCCATAATCACCCATTGCAAATCGCCGGAGACAAGATATCGTTCTTCCGCAACAAATCTGTGCTTCTGGCATTCGAGGAGACTCCTGTGAGGGTGATTCCGGAGATTCCGGAGGTCCCTTGATGTTAAATATCTGGCCGGTATCGTTTCATAT

Full Affymetrix probeset data:

Annotations for 1637358_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720