Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637359_at:

>probe:Drosophila_2:1637359_at:541:109; Interrogation_Position=1553; Antisense; AGAAGGTTATTCGAACGCACGCCCA
>probe:Drosophila_2:1637359_at:652:623; Interrogation_Position=1595; Antisense; TGCGCCACCTGCTTTGTAAATATTT
>probe:Drosophila_2:1637359_at:179:703; Interrogation_Position=1618; Antisense; TTATTTGAAGTATAGCCCTCACCAA
>probe:Drosophila_2:1637359_at:650:321; Interrogation_Position=1632; Antisense; GCCCTCACCAATCCTAGTTATAAGA
>probe:Drosophila_2:1637359_at:527:89; Interrogation_Position=1660; Antisense; AGTAGTCGCAGAGATCCGGGAGTCA
>probe:Drosophila_2:1637359_at:467:305; Interrogation_Position=1675; Antisense; CCGGGAGTCAGAAGAGAGCGTTTTT
>probe:Drosophila_2:1637359_at:560:699; Interrogation_Position=1699; Antisense; TTTTTCGTCAATTTTAGCTGTGCTA
>probe:Drosophila_2:1637359_at:316:707; Interrogation_Position=1712; Antisense; TTAGCTGTGCTAAAGTGCCACGCAT
>probe:Drosophila_2:1637359_at:727:219; Interrogation_Position=1724; Antisense; AAGTGCCACGCATGCATTGAATAAT
>probe:Drosophila_2:1637359_at:651:179; Interrogation_Position=1826; Antisense; AAACACACGCACACGGTTGGCATAG
>probe:Drosophila_2:1637359_at:17:271; Interrogation_Position=1846; Antisense; CATAGTGCGGTTTAGCTGTACGTAT
>probe:Drosophila_2:1637359_at:373:663; Interrogation_Position=1908; Antisense; TAAATTCCATTGTACGCTCGCTGGG
>probe:Drosophila_2:1637359_at:101:651; Interrogation_Position=2038; Antisense; TCACACACTTGTATGGAGAACCTAG
>probe:Drosophila_2:1637359_at:190:381; Interrogation_Position=2055; Antisense; GAACCTAGCCATAATGTTTGCTCTA

Paste this into a BLAST search page for me
AGAAGGTTATTCGAACGCACGCCCATGCGCCACCTGCTTTGTAAATATTTTTATTTGAAGTATAGCCCTCACCAAGCCCTCACCAATCCTAGTTATAAGAAGTAGTCGCAGAGATCCGGGAGTCACCGGGAGTCAGAAGAGAGCGTTTTTTTTTTCGTCAATTTTAGCTGTGCTATTAGCTGTGCTAAAGTGCCACGCATAAGTGCCACGCATGCATTGAATAATAAACACACGCACACGGTTGGCATAGCATAGTGCGGTTTAGCTGTACGTATTAAATTCCATTGTACGCTCGCTGGGTCACACACTTGTATGGAGAACCTAGGAACCTAGCCATAATGTTTGCTCTA

Full Affymetrix probeset data:

Annotations for 1637359_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime