Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637360_at:

>probe:Drosophila_2:1637360_at:238:671; Interrogation_Position=1030; Antisense; TACGATCACCAGGAGTCACTGCCGG
>probe:Drosophila_2:1637360_at:319:145; Interrogation_Position=1047; Antisense; ACTGCCGGAGCCAGTGCAAGTGCAG
>probe:Drosophila_2:1637360_at:467:387; Interrogation_Position=1114; Antisense; GAAACACCGGTTTATGCTCTGGGCC
>probe:Drosophila_2:1637360_at:381:219; Interrogation_Position=1141; Antisense; AAGGGCCTGGGTCACTTCAGCTACA
>probe:Drosophila_2:1637360_at:493:677; Interrogation_Position=1250; Antisense; TAGACGTCTCCAAGGCGCCTTTTAG
>probe:Drosophila_2:1637360_at:445:699; Interrogation_Position=1269; Antisense; TTTTAGGCCCAGTGCCTTTCTAGGG
>probe:Drosophila_2:1637360_at:723:311; Interrogation_Position=1294; Antisense; GCCAAGCACGAGTCCGGATCGAATT
>probe:Drosophila_2:1637360_at:277:451; Interrogation_Position=1310; Antisense; GATCGAATTCCATTTCCGGCTACGA
>probe:Drosophila_2:1637360_at:132:645; Interrogation_Position=1372; Antisense; TCTTCGCCAGGCTATGACTACCAGG
>probe:Drosophila_2:1637360_at:33:579; Interrogation_Position=1440; Antisense; GGCCACGCCTATTTTCGAACCGGAG
>probe:Drosophila_2:1637360_at:178:695; Interrogation_Position=1452; Antisense; TTTCGAACCGGAGGCGACCTACCTG
>probe:Drosophila_2:1637360_at:202:505; Interrogation_Position=1509; Antisense; GTCCTCCCATGGTTACCACTAAATT
>probe:Drosophila_2:1637360_at:292:659; Interrogation_Position=1547; Antisense; TAAGCTCTAGCGTCCAATGTATTTT
>probe:Drosophila_2:1637360_at:196:683; Interrogation_Position=1574; Antisense; TATCCCTATCTATTTGGTACTGCAA

Paste this into a BLAST search page for me
TACGATCACCAGGAGTCACTGCCGGACTGCCGGAGCCAGTGCAAGTGCAGGAAACACCGGTTTATGCTCTGGGCCAAGGGCCTGGGTCACTTCAGCTACATAGACGTCTCCAAGGCGCCTTTTAGTTTTAGGCCCAGTGCCTTTCTAGGGGCCAAGCACGAGTCCGGATCGAATTGATCGAATTCCATTTCCGGCTACGATCTTCGCCAGGCTATGACTACCAGGGGCCACGCCTATTTTCGAACCGGAGTTTCGAACCGGAGGCGACCTACCTGGTCCTCCCATGGTTACCACTAAATTTAAGCTCTAGCGTCCAATGTATTTTTATCCCTATCTATTTGGTACTGCAA

Full Affymetrix probeset data:

Annotations for 1637360_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime