FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637362_at:

>probe:Drosophila_2:1637362_at:6:63; Interrogation_Position=1029; Antisense; ATGTCGCATCCATCACAATTGGCCA
>probe:Drosophila_2:1637362_at:406:681; Interrogation_Position=1094; Antisense; TATGGTGACCACTGGCGATGGGCTC
>probe:Drosophila_2:1637362_at:296:579; Interrogation_Position=1140; Antisense; GGCCTGGTGGCAACATCTTCGGCAG
>probe:Drosophila_2:1637362_at:286:141; Interrogation_Position=1243; Antisense; ACGGAAGCATCGTCGGCATGGGCAT
>probe:Drosophila_2:1637362_at:70:127; Interrogation_Position=1269; Antisense; AGCCTTTATGGCAGCGATGTGGTAA
>probe:Drosophila_2:1637362_at:657:515; Interrogation_Position=1294; Antisense; GTGTCAGTTTGATGTACTTCCCCAA
>probe:Drosophila_2:1637362_at:700:283; Interrogation_Position=1332; Antisense; CTGCTGCTCCTTGTTGATAGCGAAC
>probe:Drosophila_2:1637362_at:45:675; Interrogation_Position=1349; Antisense; TAGCGAACCGGTCGTCAAGGCAACT
>probe:Drosophila_2:1637362_at:300:641; Interrogation_Position=1373; Antisense; TCTCTCGCCTAATGTCCAAAACGTT
>probe:Drosophila_2:1637362_at:337:543; Interrogation_Position=1433; Antisense; GGATTTTTGGCAGTGCTTCTTGGCA
>probe:Drosophila_2:1637362_at:684:573; Interrogation_Position=926; Antisense; GGCTGGAGCCGTGGTCGACAATATC
>probe:Drosophila_2:1637362_at:426:23; Interrogation_Position=946; Antisense; ATATCGATCTGGCACATCATCCCAT
>probe:Drosophila_2:1637362_at:338:599; Interrogation_Position=976; Antisense; TGTACTCAACGAGCCCGATGTTTGG
>probe:Drosophila_2:1637362_at:380:59; Interrogation_Position=993; Antisense; ATGTTTGGCACGAACAGCACCATCA

Paste this into a BLAST search page for me
ATGTCGCATCCATCACAATTGGCCATATGGTGACCACTGGCGATGGGCTCGGCCTGGTGGCAACATCTTCGGCAGACGGAAGCATCGTCGGCATGGGCATAGCCTTTATGGCAGCGATGTGGTAAGTGTCAGTTTGATGTACTTCCCCAACTGCTGCTCCTTGTTGATAGCGAACTAGCGAACCGGTCGTCAAGGCAACTTCTCTCGCCTAATGTCCAAAACGTTGGATTTTTGGCAGTGCTTCTTGGCAGGCTGGAGCCGTGGTCGACAATATCATATCGATCTGGCACATCATCCCATTGTACTCAACGAGCCCGATGTTTGGATGTTTGGCACGAACAGCACCATCA

Full Affymetrix probeset data:

Annotations for 1637362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720