FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637363_at:

>probe:Drosophila_2:1637363_at:577:505; Interrogation_Position=108; Antisense; GTGCCGGCAGACCAAGTTCACCAAA
>probe:Drosophila_2:1637363_at:564:267; Interrogation_Position=133; Antisense; CAGGAAATCCGCGTCATGTACAGAG
>probe:Drosophila_2:1637363_at:545:457; Interrogation_Position=208; Antisense; GATATCTACGCCAAATTCTTTCCAC
>probe:Drosophila_2:1637363_at:444:249; Interrogation_Position=288; Antisense; CAATGGCGCCATTAGTTTTCGGGAT
>probe:Drosophila_2:1637363_at:199:701; Interrogation_Position=303; Antisense; TTTTCGGGATTTACTGGTCACCTTG
>probe:Drosophila_2:1637363_at:64:129; Interrogation_Position=322; Antisense; ACCTTGTCGACCTTGCTGAGAGGTT
>probe:Drosophila_2:1637363_at:308:541; Interrogation_Position=343; Antisense; GGTTCTGTATATGAGCGTCTGCGTT
>probe:Drosophila_2:1637363_at:672:639; Interrogation_Position=360; Antisense; TCTGCGTTGGACCTTCAAGTTGTAC
>probe:Drosophila_2:1637363_at:401:139; Interrogation_Position=398; Antisense; ACGGAAGGATCAGTCGCGGCGAACT
>probe:Drosophila_2:1637363_at:115:689; Interrogation_Position=432; Antisense; TATTTTGGCCATTCACGAGCTTATG
>probe:Drosophila_2:1637363_at:122:501; Interrogation_Position=458; Antisense; GTCGGAGACCACATCAACCTGAGGA
>probe:Drosophila_2:1637363_at:556:265; Interrogation_Position=502; Antisense; CAGGTTGATCGTGTGTTTCGCAAAC
>probe:Drosophila_2:1637363_at:504:73; Interrogation_Position=560; Antisense; AGGAGTTTTTGGAGGCCTGCCTGAA
>probe:Drosophila_2:1637363_at:220:403; Interrogation_Position=589; Antisense; GACTTGGTAACTCGATCGCTGCAAA

Paste this into a BLAST search page for me
GTGCCGGCAGACCAAGTTCACCAAACAGGAAATCCGCGTCATGTACAGAGGATATCTACGCCAAATTCTTTCCACCAATGGCGCCATTAGTTTTCGGGATTTTTCGGGATTTACTGGTCACCTTGACCTTGTCGACCTTGCTGAGAGGTTGGTTCTGTATATGAGCGTCTGCGTTTCTGCGTTGGACCTTCAAGTTGTACACGGAAGGATCAGTCGCGGCGAACTTATTTTGGCCATTCACGAGCTTATGGTCGGAGACCACATCAACCTGAGGACAGGTTGATCGTGTGTTTCGCAAACAGGAGTTTTTGGAGGCCTGCCTGAAGACTTGGTAACTCGATCGCTGCAAA

Full Affymetrix probeset data:

Annotations for 1637363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720