FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637364_at:

>probe:Drosophila_2:1637364_at:179:519; Interrogation_Position=109; Antisense; GTGGGACTGCGCCAGTACCATATAG
>probe:Drosophila_2:1637364_at:287:605; Interrogation_Position=152; Antisense; TGATCTTCGGCTGCGACAACTTTGC
>probe:Drosophila_2:1637364_at:185:297; Interrogation_Position=165; Antisense; CGACAACTTTGCCAAGTGCGGCGAT
>probe:Drosophila_2:1637364_at:328:509; Interrogation_Position=22; Antisense; GTGCAGAAAGTTTTGCTCGCCGAAT
>probe:Drosophila_2:1637364_at:591:635; Interrogation_Position=227; Antisense; TCGAGAGCTTCGAGCTGGTCAGCAT
>probe:Drosophila_2:1637364_at:259:323; Interrogation_Position=297; Antisense; GCGCTGCCTCATGATGCTGAACATT
>probe:Drosophila_2:1637364_at:11:613; Interrogation_Position=314; Antisense; TGAACATTGTCGAGCCGCCGGGCGA
>probe:Drosophila_2:1637364_at:133:381; Interrogation_Position=337; Antisense; GAACCTCTCACCATTCTGGAGCAAC
>probe:Drosophila_2:1637364_at:505:551; Interrogation_Position=354; Antisense; GGAGCAACCGATGATCTTCGAGTTC
>probe:Drosophila_2:1637364_at:641:93; Interrogation_Position=374; Antisense; AGTTCGGCGGCTTTCTCTTCAAGCA
>probe:Drosophila_2:1637364_at:379:209; Interrogation_Position=394; Antisense; AAGCAGCACTTCTGGCATACGTGGC
>probe:Drosophila_2:1637364_at:107:533; Interrogation_Position=425; Antisense; GGGTGGCCACCATTCGAGTGATGCA
>probe:Drosophila_2:1637364_at:490:425; Interrogation_Position=514; Antisense; GAGACCATAGCGGTCCAGGTGCATC
>probe:Drosophila_2:1637364_at:565:587; Interrogation_Position=74; Antisense; TGGAGAATCCCTTCACGCTGGTGGA

Paste this into a BLAST search page for me
GTGGGACTGCGCCAGTACCATATAGTGATCTTCGGCTGCGACAACTTTGCCGACAACTTTGCCAAGTGCGGCGATGTGCAGAAAGTTTTGCTCGCCGAATTCGAGAGCTTCGAGCTGGTCAGCATGCGCTGCCTCATGATGCTGAACATTTGAACATTGTCGAGCCGCCGGGCGAGAACCTCTCACCATTCTGGAGCAACGGAGCAACCGATGATCTTCGAGTTCAGTTCGGCGGCTTTCTCTTCAAGCAAAGCAGCACTTCTGGCATACGTGGCGGGTGGCCACCATTCGAGTGATGCAGAGACCATAGCGGTCCAGGTGCATCTGGAGAATCCCTTCACGCTGGTGGA

Full Affymetrix probeset data:

Annotations for 1637364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720