FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637365_at:

>probe:Drosophila_2:1637365_at:649:333; Interrogation_Position=2419; Antisense; GCTGATTTTACAGACCTCTCTTATT
>probe:Drosophila_2:1637365_at:564:187; Interrogation_Position=2451; Antisense; AACACTCCATGCTATTTATTTGTAA
>probe:Drosophila_2:1637365_at:492:101; Interrogation_Position=2525; Antisense; AGAGCAAGCACTGTAATCGTAGCGT
>probe:Drosophila_2:1637365_at:303:237; Interrogation_Position=2539; Antisense; AATCGTAGCGTGTCTCAAGCAATTT
>probe:Drosophila_2:1637365_at:556:703; Interrogation_Position=2562; Antisense; TTATGTTTTAAGTACCCCAATGAAT
>probe:Drosophila_2:1637365_at:526:17; Interrogation_Position=2585; Antisense; ATTTATACATCATCCGCACAGACGC
>probe:Drosophila_2:1637365_at:10:411; Interrogation_Position=2605; Antisense; GACGCATTAATCTAACCAGCCTAAA
>probe:Drosophila_2:1637365_at:615:661; Interrogation_Position=2626; Antisense; TAAAATCTAAATCACACACACCCAC
>probe:Drosophila_2:1637365_at:185:133; Interrogation_Position=2645; Antisense; ACCCACAAAGCCCTCTGATTAAGTA
>probe:Drosophila_2:1637365_at:578:487; Interrogation_Position=2734; Antisense; GTACTTTACTTAGGTTGATCCCCAG
>probe:Drosophila_2:1637365_at:404:425; Interrogation_Position=2801; Antisense; GAGAGCGTCGATAGCAATATAGCAA
>probe:Drosophila_2:1637365_at:100:23; Interrogation_Position=2817; Antisense; ATATAGCAATCAGCTCGTCCAGGCA
>probe:Drosophila_2:1637365_at:559:505; Interrogation_Position=2833; Antisense; GTCCAGGCATAGACGACGTAGTTTT
>probe:Drosophila_2:1637365_at:20:679; Interrogation_Position=2851; Antisense; TAGTTTTCTCTGATTGTGCTGGGCA

Paste this into a BLAST search page for me
GCTGATTTTACAGACCTCTCTTATTAACACTCCATGCTATTTATTTGTAAAGAGCAAGCACTGTAATCGTAGCGTAATCGTAGCGTGTCTCAAGCAATTTTTATGTTTTAAGTACCCCAATGAATATTTATACATCATCCGCACAGACGCGACGCATTAATCTAACCAGCCTAAATAAAATCTAAATCACACACACCCACACCCACAAAGCCCTCTGATTAAGTAGTACTTTACTTAGGTTGATCCCCAGGAGAGCGTCGATAGCAATATAGCAAATATAGCAATCAGCTCGTCCAGGCAGTCCAGGCATAGACGACGTAGTTTTTAGTTTTCTCTGATTGTGCTGGGCA

Full Affymetrix probeset data:

Annotations for 1637365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720