Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637366_at:

>probe:Drosophila_2:1637366_at:304:409; Interrogation_Position=1008; Antisense; GACGATGAGCTGAATCCCTGGACCA
>probe:Drosophila_2:1637366_at:319:27; Interrogation_Position=1032; Antisense; ATACCCATCATTGGTGTTGCCTGTG
>probe:Drosophila_2:1637366_at:440:519; Interrogation_Position=1054; Antisense; GTGGATTCCTGTTTGTTCTGCTCAT
>probe:Drosophila_2:1637366_at:161:527; Interrogation_Position=1082; Antisense; GGGTCTCCTCGGTGGTAGACGATAT
>probe:Drosophila_2:1637366_at:655:457; Interrogation_Position=1102; Antisense; GATATCGCCAGGAGCGGGCTGCTTT
>probe:Drosophila_2:1637366_at:681:723; Interrogation_Position=1212; Antisense; TTGGCGTTGGGCTGTGTTATATCAA
>probe:Drosophila_2:1637366_at:408:463; Interrogation_Position=729; Antisense; GATTCGCCGAGCACCAGTTCAACAG
>probe:Drosophila_2:1637366_at:713:473; Interrogation_Position=745; Antisense; GTTCAACAGCAGTATTCACGGCCAC
>probe:Drosophila_2:1637366_at:468:143; Interrogation_Position=772; Antisense; ACTGTCCGGATGACTTTGTCCTGTT
>probe:Drosophila_2:1637366_at:616:593; Interrogation_Position=836; Antisense; TGTGGGTTGCCTTAAATCCGGCTGT
>probe:Drosophila_2:1637366_at:414:519; Interrogation_Position=859; Antisense; GTGGTCCGCATCAAACATGCCTGGA
>probe:Drosophila_2:1637366_at:398:585; Interrogation_Position=880; Antisense; TGGACTCCGGTGTATGTCAGTGCTC
>probe:Drosophila_2:1637366_at:30:143; Interrogation_Position=939; Antisense; ACTGGAGTGCTCAGCTGTCGGCGCA
>probe:Drosophila_2:1637366_at:729:619; Interrogation_Position=967; Antisense; TGCTCGACCAAATTCTCGGGCTGAA

Paste this into a BLAST search page for me
GACGATGAGCTGAATCCCTGGACCAATACCCATCATTGGTGTTGCCTGTGGTGGATTCCTGTTTGTTCTGCTCATGGGTCTCCTCGGTGGTAGACGATATGATATCGCCAGGAGCGGGCTGCTTTTTGGCGTTGGGCTGTGTTATATCAAGATTCGCCGAGCACCAGTTCAACAGGTTCAACAGCAGTATTCACGGCCACACTGTCCGGATGACTTTGTCCTGTTTGTGGGTTGCCTTAAATCCGGCTGTGTGGTCCGCATCAAACATGCCTGGATGGACTCCGGTGTATGTCAGTGCTCACTGGAGTGCTCAGCTGTCGGCGCATGCTCGACCAAATTCTCGGGCTGAA

Full Affymetrix probeset data:

Annotations for 1637366_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime