FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637367_at:

>probe:Drosophila_2:1637367_at:678:655; Interrogation_Position=103; Antisense; TAATCTCCGCCATTGTGCTGAGCGC
>probe:Drosophila_2:1637367_at:512:111; Interrogation_Position=240; Antisense; AGCAAGCGAGCTACCAAGGACACTA
>probe:Drosophila_2:1637367_at:143:559; Interrogation_Position=257; Antisense; GGACACTAGTAACAGCACGGAAGAT
>probe:Drosophila_2:1637367_at:350:55; Interrogation_Position=283; Antisense; ATGAGCTCACGGATGGTAGCAATGA
>probe:Drosophila_2:1637367_at:202:559; Interrogation_Position=326; Antisense; GGACAGCTCAATGGAATCGTCTTCT
>probe:Drosophila_2:1637367_at:411:235; Interrogation_Position=340; Antisense; AATCGTCTTCTATGCTGATCATGGC
>probe:Drosophila_2:1637367_at:84:41; Interrogation_Position=377; Antisense; ATCGGAGTCCGCTGTCAGAAGGCGC
>probe:Drosophila_2:1637367_at:322:363; Interrogation_Position=422; Antisense; GAATATAGGGCTCCTGGCCACGATT
>probe:Drosophila_2:1637367_at:147:293; Interrogation_Position=442; Antisense; CGATTTGCCCAAATGCTGATTTCAG
>probe:Drosophila_2:1637367_at:268:423; Interrogation_Position=474; Antisense; GAGAACGGTATTACCCTAGATTCTA
>probe:Drosophila_2:1637367_at:311:659; Interrogation_Position=530; Antisense; TAAAACTCTACCAGAGTCCGGTCGT
>probe:Drosophila_2:1637367_at:196:87; Interrogation_Position=544; Antisense; AGTCCGGTCGTCTACAGCAATACAA
>probe:Drosophila_2:1637367_at:53:95; Interrogation_Position=67; Antisense; AGATTACCGGGATGCGTCGATCTGT
>probe:Drosophila_2:1637367_at:330:501; Interrogation_Position=82; Antisense; GTCGATCTGTTTTGCTGTTCCTAAT

Paste this into a BLAST search page for me
TAATCTCCGCCATTGTGCTGAGCGCAGCAAGCGAGCTACCAAGGACACTAGGACACTAGTAACAGCACGGAAGATATGAGCTCACGGATGGTAGCAATGAGGACAGCTCAATGGAATCGTCTTCTAATCGTCTTCTATGCTGATCATGGCATCGGAGTCCGCTGTCAGAAGGCGCGAATATAGGGCTCCTGGCCACGATTCGATTTGCCCAAATGCTGATTTCAGGAGAACGGTATTACCCTAGATTCTATAAAACTCTACCAGAGTCCGGTCGTAGTCCGGTCGTCTACAGCAATACAAAGATTACCGGGATGCGTCGATCTGTGTCGATCTGTTTTGCTGTTCCTAAT

Full Affymetrix probeset data:

Annotations for 1637367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720