FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637369_at:

>probe:Drosophila_2:1637369_at:636:541; Interrogation_Position=1076; Antisense; GGATTCACTAGCTGGAGATCGACTA
>probe:Drosophila_2:1637369_at:518:97; Interrogation_Position=1091; Antisense; AGATCGACTAGGTTGCTTCTCCCTG
>probe:Drosophila_2:1637369_at:108:563; Interrogation_Position=1154; Antisense; GGAACTGAACGTACCCACATTGGTG
>probe:Drosophila_2:1637369_at:439:529; Interrogation_Position=1188; Antisense; GGTGGCTACACCTTACGGAACGTGG
>probe:Drosophila_2:1637369_at:47:283; Interrogation_Position=1235; Antisense; CTCGCTGCTGGTGGACCAAGACATT
>probe:Drosophila_2:1637369_at:84:401; Interrogation_Position=1254; Antisense; GACATTGAAAATGACCTACCCGCCA
>probe:Drosophila_2:1637369_at:81:313; Interrogation_Position=1275; Antisense; GCCACCGAGTATTACGACTTTTTCG
>probe:Drosophila_2:1637369_at:320:115; Interrogation_Position=1357; Antisense; AGCAGTATCTTGAACTCATCGTTAA
>probe:Drosophila_2:1637369_at:391:387; Interrogation_Position=1392; Antisense; GAAAACCTTAAGATGTGCCAGCACT
>probe:Drosophila_2:1637369_at:302:103; Interrogation_Position=1438; Antisense; AGACCCCGCCTGATGTGGACTTGGA
>probe:Drosophila_2:1637369_at:526:433; Interrogation_Position=1490; Antisense; GAGTGATCCCGACGTGCGAATATCC
>probe:Drosophila_2:1637369_at:450:507; Interrogation_Position=1503; Antisense; GTGCGAATATCCGTAGCCGATGAGG
>probe:Drosophila_2:1637369_at:484:199; Interrogation_Position=1548; Antisense; AACGAGTTCTACGACGGCGATCAGG
>probe:Drosophila_2:1637369_at:88:647; Interrogation_Position=1568; Antisense; TCAGGACCAAGACAAGCCCGATTCG

Paste this into a BLAST search page for me
GGATTCACTAGCTGGAGATCGACTAAGATCGACTAGGTTGCTTCTCCCTGGGAACTGAACGTACCCACATTGGTGGGTGGCTACACCTTACGGAACGTGGCTCGCTGCTGGTGGACCAAGACATTGACATTGAAAATGACCTACCCGCCAGCCACCGAGTATTACGACTTTTTCGAGCAGTATCTTGAACTCATCGTTAAGAAAACCTTAAGATGTGCCAGCACTAGACCCCGCCTGATGTGGACTTGGAGAGTGATCCCGACGTGCGAATATCCGTGCGAATATCCGTAGCCGATGAGGAACGAGTTCTACGACGGCGATCAGGTCAGGACCAAGACAAGCCCGATTCG

Full Affymetrix probeset data:

Annotations for 1637369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720