FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637370_at:

>probe:Drosophila_2:1637370_at:269:551; Interrogation_Position=1011; Antisense; GGAGACGACTTCCATCTTCTGGGAA
>probe:Drosophila_2:1637370_at:227:17; Interrogation_Position=1024; Antisense; ATCTTCTGGGAACTCGTGGTCCGTC
>probe:Drosophila_2:1637370_at:603:627; Interrogation_Position=1047; Antisense; TCCACCCAGTCCACAATGCATAAAT
>probe:Drosophila_2:1637370_at:281:611; Interrogation_Position=1063; Antisense; TGCATAAATACGATCCGCGGACCGG
>probe:Drosophila_2:1637370_at:479:513; Interrogation_Position=1089; Antisense; GTGATTTTCTTTGCCGAGGTCCAGA
>probe:Drosophila_2:1637370_at:696:387; Interrogation_Position=1133; Antisense; GAAAACCAGCAAGCCGTTCTCAACG
>probe:Drosophila_2:1637370_at:163:67; Interrogation_Position=1165; Antisense; ATGGCTCCGTTTATTCCAATTCATC
>probe:Drosophila_2:1637370_at:720:703; Interrogation_Position=1199; Antisense; TTATCCCAGCGATTTGACCATCGAC
>probe:Drosophila_2:1637370_at:584:271; Interrogation_Position=1262; Antisense; CATCTTTGTGTACTCCAAGCTGGAT
>probe:Drosophila_2:1637370_at:310:439; Interrogation_Position=1313; Antisense; GAGGCAGTCGACATTGCTGGCCAAG
>probe:Drosophila_2:1637370_at:227:407; Interrogation_Position=864; Antisense; GACGACGGGATTTTCTCGGCGACCT
>probe:Drosophila_2:1637370_at:436:641; Interrogation_Position=877; Antisense; TCTCGGCGACCTTGGGATCATATAA
>probe:Drosophila_2:1637370_at:561:67; Interrogation_Position=907; Antisense; ATGGCAGCAGGGATGTCTTCTTCCA
>probe:Drosophila_2:1637370_at:177:233; Interrogation_Position=990; Antisense; AATGCAGCACGTTCTGATCATGGAG

Paste this into a BLAST search page for me
GGAGACGACTTCCATCTTCTGGGAAATCTTCTGGGAACTCGTGGTCCGTCTCCACCCAGTCCACAATGCATAAATTGCATAAATACGATCCGCGGACCGGGTGATTTTCTTTGCCGAGGTCCAGAGAAAACCAGCAAGCCGTTCTCAACGATGGCTCCGTTTATTCCAATTCATCTTATCCCAGCGATTTGACCATCGACCATCTTTGTGTACTCCAAGCTGGATGAGGCAGTCGACATTGCTGGCCAAGGACGACGGGATTTTCTCGGCGACCTTCTCGGCGACCTTGGGATCATATAAATGGCAGCAGGGATGTCTTCTTCCAAATGCAGCACGTTCTGATCATGGAG

Full Affymetrix probeset data:

Annotations for 1637370_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720