FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637374_at:

>probe:Drosophila_2:1637374_at:437:481; Interrogation_Position=108; Antisense; GTATAAGCAGCTTCCGTTTACCGCT
>probe:Drosophila_2:1637374_at:611:47; Interrogation_Position=13; Antisense; ATGGCAAATGGCACTTTCGAATTGA
>probe:Drosophila_2:1637374_at:255:181; Interrogation_Position=136; Antisense; AAACAATCCGTCTGCACGGCATTGA
>probe:Drosophila_2:1637374_at:565:341; Interrogation_Position=154; Antisense; GCATTGAAGGCCTATTGGTCGTACT
>probe:Drosophila_2:1637374_at:249:727; Interrogation_Position=168; Antisense; TTGGTCGTACTTTGAGCCGAGTATA
>probe:Drosophila_2:1637374_at:357:409; Interrogation_Position=200; Antisense; GAGTTAAGACGGACTTTCCCGCTCA
>probe:Drosophila_2:1637374_at:571:45; Interrogation_Position=230; Antisense; ATCCATGTCCCCTACCAAAGGGAAT
>probe:Drosophila_2:1637374_at:484:313; Interrogation_Position=294; Antisense; GCCAGTCATAATGCCGCGAGGTTAT
>probe:Drosophila_2:1637374_at:576:287; Interrogation_Position=310; Antisense; CGAGGTTATCTAAAGGCCGTGGCCA
>probe:Drosophila_2:1637374_at:123:525; Interrogation_Position=324; Antisense; GGCCGTGGCCAATCTTTTCAAAAAT
>probe:Drosophila_2:1637374_at:259:69; Interrogation_Position=356; Antisense; ATGGCGGCAGTCTAGAAATTGTTTC
>probe:Drosophila_2:1637374_at:269:479; Interrogation_Position=376; Antisense; GTTTCACAAATTAGCGACTTGTCTT
>probe:Drosophila_2:1637374_at:532:53; Interrogation_Position=53; Antisense; ATGAATCATTTTCAGTCGTCGGTGA
>probe:Drosophila_2:1637374_at:354:389; Interrogation_Position=76; Antisense; GAAACTTTCATCGATTCTGTGGGCG

Paste this into a BLAST search page for me
GTATAAGCAGCTTCCGTTTACCGCTATGGCAAATGGCACTTTCGAATTGAAAACAATCCGTCTGCACGGCATTGAGCATTGAAGGCCTATTGGTCGTACTTTGGTCGTACTTTGAGCCGAGTATAGAGTTAAGACGGACTTTCCCGCTCAATCCATGTCCCCTACCAAAGGGAATGCCAGTCATAATGCCGCGAGGTTATCGAGGTTATCTAAAGGCCGTGGCCAGGCCGTGGCCAATCTTTTCAAAAATATGGCGGCAGTCTAGAAATTGTTTCGTTTCACAAATTAGCGACTTGTCTTATGAATCATTTTCAGTCGTCGGTGAGAAACTTTCATCGATTCTGTGGGCG

Full Affymetrix probeset data:

Annotations for 1637374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720