Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637376_at:

>probe:Drosophila_2:1637376_at:277:471; Interrogation_Position=13; Antisense; GTTCGACGTACCTTTGTCACATTTT
>probe:Drosophila_2:1637376_at:30:51; Interrogation_Position=140; Antisense; ATGCCTGTTTCAACAGCTGGTTTTC
>probe:Drosophila_2:1637376_at:430:333; Interrogation_Position=155; Antisense; GCTGGTTTTCTGAACGCTTCCTAAA
>probe:Drosophila_2:1637376_at:304:229; Interrogation_Position=186; Antisense; AATGGATGACTCAGCGTGTGCTCCG
>probe:Drosophila_2:1637376_at:725:617; Interrogation_Position=204; Antisense; TGCTCCGATTTTCCGGGTTTATCAG
>probe:Drosophila_2:1637376_at:576:675; Interrogation_Position=223; Antisense; TATCAGGAATGCGTCAAGGTGAGCT
>probe:Drosophila_2:1637376_at:179:221; Interrogation_Position=238; Antisense; AAGGTGAGCTAATCGGCTCCCTAAC
>probe:Drosophila_2:1637376_at:108:537; Interrogation_Position=252; Antisense; GGCTCCCTAACCACGTATGGTTTGA
>probe:Drosophila_2:1637376_at:201:539; Interrogation_Position=270; Antisense; GGTTTGACCAACCTGTAATCCCCAG
>probe:Drosophila_2:1637376_at:440:493; Interrogation_Position=28; Antisense; GTCACATTTTTTCGGAACTCTATAA
>probe:Drosophila_2:1637376_at:641:45; Interrogation_Position=287; Antisense; ATCCCCAGCGCGCTATTAAGGAGAA
>probe:Drosophila_2:1637376_at:350:97; Interrogation_Position=333; Antisense; AGATCCGATCTTCGAAACCGGGCTT
>probe:Drosophila_2:1637376_at:499:123; Interrogation_Position=349; Antisense; ACCGGGCTTGAGGAGAATAATGCGA
>probe:Drosophila_2:1637376_at:328:257; Interrogation_Position=91; Antisense; CAAATGAGCAGCGTTGGCGAGGATT

Paste this into a BLAST search page for me
GTTCGACGTACCTTTGTCACATTTTATGCCTGTTTCAACAGCTGGTTTTCGCTGGTTTTCTGAACGCTTCCTAAAAATGGATGACTCAGCGTGTGCTCCGTGCTCCGATTTTCCGGGTTTATCAGTATCAGGAATGCGTCAAGGTGAGCTAAGGTGAGCTAATCGGCTCCCTAACGGCTCCCTAACCACGTATGGTTTGAGGTTTGACCAACCTGTAATCCCCAGGTCACATTTTTTCGGAACTCTATAAATCCCCAGCGCGCTATTAAGGAGAAAGATCCGATCTTCGAAACCGGGCTTACCGGGCTTGAGGAGAATAATGCGACAAATGAGCAGCGTTGGCGAGGATT

Full Affymetrix probeset data:

Annotations for 1637376_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime