FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637379_at:

>probe:Drosophila_2:1637379_at:42:679; Interrogation_Position=162; Antisense; TAGATTTCAGCACGGAGGCAGCCAG
>probe:Drosophila_2:1637379_at:339:577; Interrogation_Position=198; Antisense; GGCCCAGATTCCCACGGAGAACAGT
>probe:Drosophila_2:1637379_at:692:105; Interrogation_Position=215; Antisense; AGAACAGTGCCGAGTTTAACGCCCT
>probe:Drosophila_2:1637379_at:175:587; Interrogation_Position=251; Antisense; TGGACTCCACGGATGGCGTCTGCAT
>probe:Drosophila_2:1637379_at:259:347; Interrogation_Position=272; Antisense; GCATCGAGCGACAGGCGGTTGACAA
>probe:Drosophila_2:1637379_at:110:553; Interrogation_Position=312; Antisense; GGAGCCCCTGCATTGGTTCTCGGTA
>probe:Drosophila_2:1637379_at:488:131; Interrogation_Position=342; Antisense; ACCGATGAGCTTGCGCAATGCTGTT
>probe:Drosophila_2:1637379_at:230:75; Interrogation_Position=377; Antisense; AGGACTGCATAGAGCTGGTCGCCGA
>probe:Drosophila_2:1637379_at:526:535; Interrogation_Position=393; Antisense; GGTCGCCGAGAGCACTAATCTGCAG
>probe:Drosophila_2:1637379_at:395:423; Interrogation_Position=428; Antisense; GAGAAGCGCTGGATTCGATCACAAA
>probe:Drosophila_2:1637379_at:361:173; Interrogation_Position=450; Antisense; AAAGCTGCGAAGGAGTGCCCTGCTT
>probe:Drosophila_2:1637379_at:449:313; Interrogation_Position=47; Antisense; GCCAGCTACTGGATGACTTGTACCT
>probe:Drosophila_2:1637379_at:44:559; Interrogation_Position=72; Antisense; GGACATGTTCCACCTCGTTGAGGAG
>probe:Drosophila_2:1637379_at:394:437; Interrogation_Position=91; Antisense; GAGGAGCACACCCAGTGTCGGATAA

Paste this into a BLAST search page for me
TAGATTTCAGCACGGAGGCAGCCAGGGCCCAGATTCCCACGGAGAACAGTAGAACAGTGCCGAGTTTAACGCCCTTGGACTCCACGGATGGCGTCTGCATGCATCGAGCGACAGGCGGTTGACAAGGAGCCCCTGCATTGGTTCTCGGTAACCGATGAGCTTGCGCAATGCTGTTAGGACTGCATAGAGCTGGTCGCCGAGGTCGCCGAGAGCACTAATCTGCAGGAGAAGCGCTGGATTCGATCACAAAAAAGCTGCGAAGGAGTGCCCTGCTTGCCAGCTACTGGATGACTTGTACCTGGACATGTTCCACCTCGTTGAGGAGGAGGAGCACACCCAGTGTCGGATAA

Full Affymetrix probeset data:

Annotations for 1637379_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720