FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637382_at:

>probe:Drosophila_2:1637382_at:210:411; Interrogation_Position=109; Antisense; GACGCCGCCCAAGGAGGTAGCTATC
>probe:Drosophila_2:1637382_at:393:547; Interrogation_Position=121; Antisense; GGAGGTAGCTATCCAATCACGGAGC
>probe:Drosophila_2:1637382_at:362:683; Interrogation_Position=130; Antisense; TATCCAATCACGGAGCTGATGCGAA
>probe:Drosophila_2:1637382_at:670:333; Interrogation_Position=144; Antisense; GCTGATGCGAAACGGCAAACCTGTT
>probe:Drosophila_2:1637382_at:470:391; Interrogation_Position=152; Antisense; GAAACGGCAAACCTGTTCATTACAA
>probe:Drosophila_2:1637382_at:20:203; Interrogation_Position=161; Antisense; AACCTGTTCATTACAACATTGGAAG
>probe:Drosophila_2:1637382_at:615:93; Interrogation_Position=17; Antisense; AGTTGTTGGCTGTTCTTTTTGCCGT
>probe:Drosophila_2:1637382_at:566:723; Interrogation_Position=22; Antisense; TTGGCTGTTCTTTTTGCCGTTTTGG
>probe:Drosophila_2:1637382_at:81:317; Interrogation_Position=37; Antisense; GCCGTTTTGGCCGTTGTCCTGATGA
>probe:Drosophila_2:1637382_at:134:729; Interrogation_Position=43; Antisense; TTGGCCGTTGTCCTGATGACTGCCG
>probe:Drosophila_2:1637382_at:571:55; Interrogation_Position=58; Antisense; ATGACTGCCGCTCCAGTTTTTGGTA
>probe:Drosophila_2:1637382_at:397:625; Interrogation_Position=63; Antisense; TGCCGCTCCAGTTTTTGGTAATGTC
>probe:Drosophila_2:1637382_at:559:699; Interrogation_Position=74; Antisense; TTTTTGGTAATGTCCCACAGTGCGA
>probe:Drosophila_2:1637382_at:22:537; Interrogation_Position=79; Antisense; GGTAATGTCCCACAGTGCGAACCCA

Paste this into a BLAST search page for me
GACGCCGCCCAAGGAGGTAGCTATCGGAGGTAGCTATCCAATCACGGAGCTATCCAATCACGGAGCTGATGCGAAGCTGATGCGAAACGGCAAACCTGTTGAAACGGCAAACCTGTTCATTACAAAACCTGTTCATTACAACATTGGAAGAGTTGTTGGCTGTTCTTTTTGCCGTTTGGCTGTTCTTTTTGCCGTTTTGGGCCGTTTTGGCCGTTGTCCTGATGATTGGCCGTTGTCCTGATGACTGCCGATGACTGCCGCTCCAGTTTTTGGTATGCCGCTCCAGTTTTTGGTAATGTCTTTTTGGTAATGTCCCACAGTGCGAGGTAATGTCCCACAGTGCGAACCCA

Full Affymetrix probeset data:

Annotations for 1637382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720